ID: 1018527499

View in Genome Browser
Species Human (GRCh38)
Location 6:164729104-164729126
Sequence CTAGTGGAGCTGTGGGAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 6389
Summary {0: 42, 1: 1749, 2: 2157, 3: 1421, 4: 1020}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018527493_1018527499 -5 Left 1018527493 6:164729086-164729108 CCTTCACTGAGGCACTGCCTAGT No data
Right 1018527499 6:164729104-164729126 CTAGTGGAGCTGTGGGAAGAGGG 0: 42
1: 1749
2: 2157
3: 1421
4: 1020
1018527489_1018527499 7 Left 1018527489 6:164729074-164729096 CCCCACACAGAGCCTTCACTGAG No data
Right 1018527499 6:164729104-164729126 CTAGTGGAGCTGTGGGAAGAGGG 0: 42
1: 1749
2: 2157
3: 1421
4: 1020
1018527490_1018527499 6 Left 1018527490 6:164729075-164729097 CCCACACAGAGCCTTCACTGAGG No data
Right 1018527499 6:164729104-164729126 CTAGTGGAGCTGTGGGAAGAGGG 0: 42
1: 1749
2: 2157
3: 1421
4: 1020
1018527492_1018527499 5 Left 1018527492 6:164729076-164729098 CCACACAGAGCCTTCACTGAGGC No data
Right 1018527499 6:164729104-164729126 CTAGTGGAGCTGTGGGAAGAGGG 0: 42
1: 1749
2: 2157
3: 1421
4: 1020

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018527499 Original CRISPR CTAGTGGAGCTGTGGGAAGA GGG Intergenic
Too many off-targets to display for this crispr