ID: 1018527500

View in Genome Browser
Species Human (GRCh38)
Location 6:164729125-164729147
Sequence GGCCACTGTCCTCCAGACCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 846
Summary {0: 11, 1: 29, 2: 65, 3: 111, 4: 630}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018527497_1018527500 -1 Left 1018527497 6:164729103-164729125 CCTAGTGGAGCTGTGGGAAGAGG 0: 37
1: 1650
2: 2179
3: 1703
4: 1309
Right 1018527500 6:164729125-164729147 GGCCACTGTCCTCCAGACCCTGG 0: 11
1: 29
2: 65
3: 111
4: 630
1018527490_1018527500 27 Left 1018527490 6:164729075-164729097 CCCACACAGAGCCTTCACTGAGG No data
Right 1018527500 6:164729125-164729147 GGCCACTGTCCTCCAGACCCTGG 0: 11
1: 29
2: 65
3: 111
4: 630
1018527489_1018527500 28 Left 1018527489 6:164729074-164729096 CCCCACACAGAGCCTTCACTGAG No data
Right 1018527500 6:164729125-164729147 GGCCACTGTCCTCCAGACCCTGG 0: 11
1: 29
2: 65
3: 111
4: 630
1018527493_1018527500 16 Left 1018527493 6:164729086-164729108 CCTTCACTGAGGCACTGCCTAGT No data
Right 1018527500 6:164729125-164729147 GGCCACTGTCCTCCAGACCCTGG 0: 11
1: 29
2: 65
3: 111
4: 630
1018527492_1018527500 26 Left 1018527492 6:164729076-164729098 CCACACAGAGCCTTCACTGAGGC No data
Right 1018527500 6:164729125-164729147 GGCCACTGTCCTCCAGACCCTGG 0: 11
1: 29
2: 65
3: 111
4: 630

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018527500 Original CRISPR GGCCACTGTCCTCCAGACCC TGG Intergenic
900040994 1:464335-464357 GGCTGCTGTCCTCCAGACCCCGG - Intergenic
900062423 1:699311-699333 GGCTGCTGTCCTCCAGACCCCGG - Intergenic
900091946 1:924485-924507 GGCCACGTTCCACCCGACCCTGG + Intergenic
900219588 1:1500508-1500530 CGCCACTGCCCTCCAGTCTCTGG + Intergenic
900315458 1:2053976-2053998 GGCGTCTGTCCCCCAGGCCCAGG + Intronic
900323841 1:2097710-2097732 GGCCACTGTCCCCAGGAGCCTGG - Intronic
900339597 1:2181686-2181708 GCCCAGGGTCCTCCAGCCCCTGG - Intronic
900368628 1:2321671-2321693 GGCCCCTGTGCCCCCGACCCTGG + Intronic
900376476 1:2357108-2357130 GGCCACTGGCCTCGAGGCCTGGG + Intronic
900401903 1:2476135-2476157 GGCCCCAGGCCACCAGACCCAGG - Intronic
900792981 1:4691816-4691838 GGCCCATGACCTGCAGACCCAGG + Intronic
901048935 1:6416506-6416528 GCCCACTGACCTCCTGACTCAGG + Exonic
901164405 1:7207626-7207648 AGCCACTGGCCTCGTGACCCAGG - Intronic
901369133 1:8781312-8781334 TGCCGCTGTACTCCAGAGCCTGG + Intronic
901705827 1:11072367-11072389 TGCTACTGTCCTCCAGGCACTGG + Intronic
901848033 1:11996994-11997016 CGCCACTGTACTCCAAACCTGGG + Intronic
902281994 1:15381536-15381558 GGTCTCTGTCCTCCTGTCCCAGG - Intronic
902283867 1:15393821-15393843 GGCCTTTGTCCTCCAAACACTGG - Intronic
902291131 1:15435903-15435925 GGCCAGTCTGCTTCAGACCCAGG - Intergenic
902362011 1:15947022-15947044 GGCCACTTTCCTCCAAATGCAGG - Exonic
902540736 1:17152691-17152713 GGCCACCAAACTCCAGACCCTGG + Intergenic
902760063 1:18575303-18575325 GGGCTCTGTCCTCCAGAGCAGGG + Intergenic
902974713 1:20080538-20080560 GGCTACTGTCCTCCAGTCTGAGG + Intronic
903198130 1:21708949-21708971 TGCCACTGTACTCCAGCCCAGGG - Intronic
903324898 1:22563946-22563968 TCCCACTGTCCCCCAGTCCCCGG - Intronic
903510231 1:23869177-23869199 CGCCACTGCACTCCAGCCCCTGG + Intergenic
903740890 1:25557753-25557775 GGTCACTGTCCTCCACACTCTGG - Intronic
904142597 1:28365629-28365651 CGCCACTGCACTCCAGAGCCTGG - Intergenic
904158962 1:28508032-28508054 TGCCACTGTACTCCAACCCCAGG + Intronic
904375157 1:30076479-30076501 GGCCACTGTCCTCTAGACCCCGG + Intergenic
904679633 1:32220216-32220238 TGCCACTGCACTCCAGTCCCTGG - Intronic
904772971 1:32891160-32891182 GGCCTCTGCTATCCAGACCCTGG + Intronic
904851391 1:33462302-33462324 TGCCACTGCACTCCAGAGCCTGG + Intergenic
905095313 1:35465142-35465164 GGCCACTGTCCTCCAGACCCTGG + Intronic
905826483 1:41029252-41029274 CGCCACTGCACTCCAGCCCCTGG - Intronic
905851771 1:41280051-41280073 TGCCCCTGACCTCCAGCCCCAGG + Intergenic
906019545 1:42615337-42615359 GGCCACTGCACTCCAGAGTCTGG - Intronic
906034598 1:42742298-42742320 GGCCTCTGGGCTCCTGACCCAGG - Intergenic
906062472 1:42958012-42958034 GGGCACTTTTCTCCAGGCCCGGG - Intronic
906470404 1:46125055-46125077 TGCCACTGTACTCCAGACTGGGG + Intronic
906591998 1:47033818-47033840 TGCCATTACCCTCCAGACCCAGG + Intronic
906991806 1:50747173-50747195 GGCCACCATCATCCAGACCCTGG + Intronic
907727041 1:57029474-57029496 GGCCACTGTCCTCTAGACCCAGG + Intronic
908764510 1:67542312-67542334 CGCCACTGTACTCCAGCCTCGGG - Intergenic
908820750 1:68083997-68084019 TGCCATTGTCCTCCACACTCAGG - Intergenic
908882027 1:68743229-68743251 GGCCACTGTCCTCCAGACCCCGG + Intergenic
909439794 1:75684817-75684839 GGCCACCATCCTTCAGACTCCGG - Intergenic
909695670 1:78465642-78465664 GGCGGCTGTCCTGCAGGCCCAGG + Intronic
909699879 1:78511138-78511160 GGCCACCATCCTCCAGACCCTGG - Intronic
911686234 1:100780541-100780563 GGCCACCATCCTCCAGACCCCGG - Intergenic
911861236 1:102951696-102951718 CGCCACTGCACTCCAGAGCCTGG + Intronic
912009984 1:104947564-104947586 GGCCACTGACCTCCAGACCCAGG + Intergenic
912017616 1:105061046-105061068 GCCCACTGTCCTGCAAAACCTGG - Intergenic
912073186 1:105839631-105839653 GGCCACTGTCCTCCAGAACCCGG + Intergenic
912084059 1:105977123-105977145 GGTGACCATCCTCCAGACCCTGG + Intergenic
912908118 1:113728866-113728888 TGCCACTGCACTCCAGTCCCTGG + Intronic
912982467 1:114388010-114388032 CGCCACTGCACTCCAGAGCCTGG - Intergenic
913107614 1:115629091-115629113 TGCCACTGCACTCCAGAGCCTGG - Intergenic
913208416 1:116563375-116563397 GGCCATCATCCACCAGACCCCGG - Intronic
913485008 1:119326294-119326316 GGCCACTGAGTTCCAGTCCCAGG + Intergenic
914784400 1:150815505-150815527 CGCCACTGCACTCCAGAGCCTGG + Intronic
915811771 1:158920635-158920657 AGTTACTGTTCTCCAGACCCTGG + Intergenic
915907017 1:159886296-159886318 TGCCACTGCACTCCAGAGCCTGG + Intronic
916398415 1:164417729-164417751 ACCCACTCTCCTCAAGACCCCGG + Intergenic
916992451 1:170258869-170258891 GGCCACTTTCTTTCTGACCCTGG + Intergenic
917035422 1:170742885-170742907 CACCACCATCCTCCAGACCCCGG - Intergenic
919536705 1:198796789-198796811 GGCTACCATCCTCCATACCCCGG - Intergenic
919839011 1:201595704-201595726 GGCCACTGTCTTCCAGCCAAGGG + Intergenic
920220960 1:204400193-204400215 TGCCACTGTACTTCAGAGCCTGG + Intergenic
921861838 1:220048956-220048978 TGCCACTGTACTCCAGCCCGGGG + Intergenic
921895443 1:220395167-220395189 CGCCACTGCCCTCCAGAGCCTGG + Intergenic
921930799 1:220752803-220752825 CGCCGCTGTACTCCAGAGCCTGG + Intronic
923205270 1:231753103-231753125 GGCCACCATCCTGCAGACCCTGG - Intronic
923563129 1:235056819-235056841 AGCCACTGCACTCCAGCCCCTGG + Intergenic
923920450 1:238558600-238558622 CCCCACTGACCTGCAGACCCAGG - Intergenic
923932868 1:238722316-238722338 GGCCACTGTCCTCCAGACTCCGG + Intergenic
924047851 1:240050846-240050868 TGCCACTGTCCCCCAGACTTTGG - Intronic
924899347 1:248379131-248379153 TGCCACTGTGCTCCAGCCCGAGG + Intergenic
1062888830 10:1040249-1040271 GACCACTGTCCTACAGAGTCAGG - Exonic
1062919270 10:1266750-1266772 GGCCCGTGTCCTCCAGGCCAGGG - Intronic
1063123684 10:3122605-3122627 GGCCACTGTCCTGAAGCCGCCGG + Intronic
1063660614 10:8033464-8033486 GGCCACACTCACCCAGACCCAGG + Intergenic
1063674180 10:8125186-8125208 TGCCCCTGGCCTCCAGACCTGGG - Intergenic
1063767658 10:9160832-9160854 GGCCACCAACCTCCAGACCCTGG + Intergenic
1064901978 10:20304680-20304702 GGCAACTGCCATCCAGACTCAGG - Intergenic
1065548705 10:26848155-26848177 TGCCACTGCACTCCAGAACCTGG + Intronic
1066367094 10:34787820-34787842 CGCCACTGTACACCAGAGCCTGG - Intronic
1066599912 10:37093524-37093546 GGCCACCATCCTCCAGACCCCGG + Intergenic
1067085801 10:43237501-43237523 AGACACAGTCCTCCTGACCCCGG + Intronic
1067518032 10:46971391-46971413 CGCCACTGCACTCCAGCCCCGGG + Intronic
1067644216 10:48080437-48080459 CGCCACTGCACTCCAGCCCCGGG - Intergenic
1068580147 10:58730460-58730482 GGCCACTGTCCTCCAAACCTTGG - Intronic
1068699150 10:60001543-60001565 GGCCACTGTACTCCAGCCTGGGG + Intergenic
1069527636 10:69187390-69187412 AGCCACTGCACTCCAGAGCCTGG - Intronic
1069932303 10:71891103-71891125 GGCCATTGTCCTAGAGTCCCTGG + Intergenic
1070737345 10:78872306-78872328 TGCCACTGCCCTCCAGCCTCGGG - Intergenic
1071570251 10:86692763-86692785 AGTCTCTGTCCTCCAGGCCCAGG + Intronic
1072574643 10:96688754-96688776 TGCCACTGTACTCCAGGCCTGGG + Intronic
1072940589 10:99760252-99760274 GGCCACTGCCCTCCAGACCTTGG - Intergenic
1072954646 10:99877820-99877842 CGCCACTGGACTCCAGACCCTGG + Intronic
1073301844 10:102475666-102475688 GCCCACTGTCCTCCAAGCCTTGG - Intronic
1076350495 10:129811741-129811763 GGCCCCTGTCCCCCAGGGCCTGG + Intergenic
1076534238 10:131166734-131166756 GGCCCTGGTCCTCCACACCCAGG + Intronic
1076763219 10:132615969-132615991 GGCCCCTGTTCCCCAGGCCCAGG - Intronic
1076828377 10:132981856-132981878 CGCCTCTGTCCTCCAGGCCGAGG - Intergenic
1076875792 10:133214933-133214955 GGCCAGAGTCCCCCAGCCCCAGG + Intronic
1076967265 11:100565-100587 GGCTGCTGTCCTCCAGACCCCGG - Intergenic
1077152469 11:1078433-1078455 GGCCACGGTGCTGCAGACGCAGG - Intergenic
1077278809 11:1732683-1732705 GGCCCCTGGCTTCCATACCCTGG - Exonic
1077845186 11:6015471-6015493 GGCCACCATCCTCCAGATTCTGG + Intergenic
1078215891 11:9311553-9311575 GGCCCCTGTCCTCCTCCCCCAGG - Intronic
1078311477 11:10247651-10247673 TGCCACTGTACTCCAGGCCTGGG + Intronic
1079051372 11:17163262-17163284 CGCCACTGCACTCCAGAGCCTGG + Intronic
1079108978 11:17593474-17593496 GGCCTCTGTGTTCCTGACCCTGG - Intronic
1079437029 11:20466448-20466470 GTCCTCTGTCCTCCCAACCCAGG + Intronic
1080192728 11:29570899-29570921 GACCACTATTCTCTAGACCCTGG - Intergenic
1080359298 11:31494044-31494066 GGCCATGGTCCTCCAGACCCCGG - Intronic
1080966187 11:37217548-37217570 GGCCACCATCCTTCAGACCCCGG - Intergenic
1080973286 11:37303936-37303958 GGTCACTGTCCTACAGATGCTGG - Intergenic
1081238937 11:40679887-40679909 GGCCACCATCCTCCAGACCCCGG + Intronic
1081670869 11:44941833-44941855 AGCCACTGCCCACCAGGCCCAGG + Intronic
1081673415 11:44954509-44954531 GGCCTCTCTCCTGCAGTCCCAGG - Intergenic
1081794818 11:45811909-45811931 GGCCACTGCCCAGCAGCCCCTGG - Exonic
1081954249 11:47075882-47075904 CGCCACTGTACTCCAGGCCTGGG + Intronic
1082021938 11:47541646-47541668 CACCACTGTACTCCAGAGCCTGG + Intronic
1082859918 11:57845818-57845840 TGCCACTGACCTCCAGACTTGGG - Intergenic
1083620775 11:64048349-64048371 GGCCTCTGTCCTGCTGACCCCGG - Intronic
1084175636 11:67420881-67420903 AGCCACCGCCCTCCAGCCCCTGG - Intronic
1084404217 11:68961596-68961618 TGCCACTGCACTCCAGAGCCTGG - Intergenic
1084411599 11:69009162-69009184 TGCCACTCTGCTCCTGACCCAGG + Intronic
1084492932 11:69488205-69488227 GGCCTCTGTCCTTCAGGCCATGG + Intergenic
1085523735 11:77152704-77152726 GGCCTCTGTCCCCCAGGGCCTGG - Intronic
1086328018 11:85724531-85724553 GGGCACTGTCCCCAAGAACCTGG + Intronic
1086338827 11:85826589-85826611 GCCCCTTGTCCTCCAGACGCTGG - Intergenic
1087433371 11:98081326-98081348 GGCCACCATCCTCCACACCCTGG + Intergenic
1087437848 11:98145269-98145291 AACCACTGCCCTCCAGACCCCGG - Intergenic
1088040152 11:105371563-105371585 GGCCATTATCCCCCAGACCCAGG - Intergenic
1088109670 11:106247088-106247110 GGCCACCATCCTCCAGGCCCTGG + Intergenic
1088172382 11:107013587-107013609 CACCACTGCACTCCAGACCCTGG - Intronic
1088269160 11:108016306-108016328 CGCCACTGTACTCCAGACTGGGG - Intronic
1089169592 11:116502845-116502867 GGCCACTGGCCTCCAGCCATGGG + Intergenic
1089378571 11:118011957-118011979 GGAGAATGGCCTCCAGACCCTGG + Intergenic
1090122690 11:124049401-124049423 AGCCACTGTGCTCCAGAGCCTGG - Intergenic
1090180765 11:124697242-124697264 TACCACTGACCTACAGACCCAGG - Exonic
1090205621 11:124882468-124882490 GGCAGCTGCCCTCCAGTCCCAGG + Intergenic
1090490835 11:127159370-127159392 GACCACTGTCCTCCACAATCCGG - Intergenic
1091261878 11:134241236-134241258 GACCACTGTCATCCAGAGGCTGG + Intronic
1091680185 12:2521502-2521524 GGATGCTGTCCTCCAGGCCCTGG - Intronic
1092273524 12:7041642-7041664 GGTCATTGTCCTCCAGAACAGGG - Intronic
1092487323 12:8914338-8914360 GGCCTCTGCGCTCCAGGCCCAGG - Intronic
1092853049 12:12648075-12648097 AGCCACCATCCTCCATACCCTGG - Intergenic
1093570743 12:20663344-20663366 GGCCATTGTCCTCCAGACCCCGG + Intronic
1093788171 12:23216282-23216304 TGCCACCATCCTCCAGACCCCGG + Intergenic
1093894813 12:24563309-24563331 GGCCACTGCCTCCCAGAGCCAGG + Intergenic
1094040264 12:26114430-26114452 GTCCACAGTTCTCCAGACGCTGG - Intergenic
1094471322 12:30804260-30804282 GGCCACCATCTTCCAGACCCTGG - Intergenic
1095038776 12:37420897-37420919 GACAACTGGCCTCCTGACCCAGG + Intergenic
1095530570 12:43182140-43182162 GGCCACCATCCTCCAGACCTTGG - Intergenic
1095986845 12:48004722-48004744 GGCCCCTGCCCCCCAAACCCGGG + Intergenic
1096622555 12:52873761-52873783 GGCCACTGTCCCTAAGACCTTGG - Intergenic
1096709276 12:53443486-53443508 GGCCCCTGTCCTCCTCCCCCAGG + Exonic
1097480396 12:60116940-60116962 GGCCACCATTCTCCAGACTCCGG - Intergenic
1097558122 12:61166256-61166278 GGCCATTGTCTTCCAGACCCCGG - Intergenic
1097630262 12:62052235-62052257 TGCCACTGCCTTCCAGTCCCTGG - Intronic
1097788385 12:63787069-63787091 TGCCACTGCCCTCCAACCCCGGG + Intronic
1097869765 12:64591432-64591454 CGCCACTGCACTCCAGGCCCGGG + Intergenic
1099206977 12:79739859-79739881 TGCCACTGCACTCCAGAGCCTGG - Intergenic
1099495726 12:83343546-83343568 GTCCACTTTCCTGCAGACACTGG + Intergenic
1099558974 12:84148915-84148937 GACCACCATCCTCCACACCCCGG + Intergenic
1099780110 12:87183340-87183362 GGCCATCGTCCTCCAGACTCCGG + Intergenic
1100199993 12:92288125-92288147 CGCCACTGCACTCCAGAGCCTGG - Intergenic
1101133901 12:101719113-101719135 GGCCACTGCACTCCAGCCCTGGG + Intronic
1101340260 12:103836892-103836914 GGCCACTCTCCTCCAGACCCCGG - Intronic
1101366316 12:104074178-104074200 TGCCACTGTACTCCAGCCCCAGG - Intronic
1101370416 12:104123917-104123939 AGCCACTGTACTCCAGGCCTGGG + Intronic
1101389735 12:104289486-104289508 GGTTGCTCTCCTCCAGACCCTGG - Intronic
1101779404 12:107822341-107822363 GGCCACTGGACTACAGACACGGG + Intergenic
1101785505 12:107879529-107879551 TGCCACTGCACTCCAGTCCCTGG + Intergenic
1101874420 12:108589289-108589311 GCCCACTGCCCCCCAGCCCCAGG + Intergenic
1101979889 12:109396867-109396889 TGCCACTGTACTCCAGGCCTGGG - Intronic
1102176821 12:110882123-110882145 GCCCAGTTTCCTCCAGACGCCGG - Intronic
1102598568 12:114012117-114012139 GACCACAGTCCCCCACACCCCGG - Intergenic
1103205888 12:119128571-119128593 GGCCAATGTCCTCCAGAAAAAGG - Intronic
1103223626 12:119267599-119267621 GGTCACCATCCTTCAGACCCCGG + Intergenic
1103328690 12:120138715-120138737 GGAGAATGTCCTCCAGAGCCTGG + Exonic
1103545278 12:121696592-121696614 GGCCACTGTACTCCAGCCTGGGG + Intergenic
1103916629 12:124379128-124379150 TGCCACTCTCGTCCAGAGCCTGG - Intronic
1104970915 12:132530323-132530345 GGCCACAGTCCTCCTGCCCATGG - Intronic
1105341364 13:19529074-19529096 TGCCACTGTACTCCAGCCCCTGG + Intronic
1105507318 13:21021429-21021451 TGCCACTGCACTCCAGAGCCCGG + Intronic
1105635894 13:22214997-22215019 CGCCACTGCACTCCAGAGCCTGG + Intergenic
1105877540 13:24572282-24572304 TGCCACTGTACTCCAGCCCCTGG - Intergenic
1106332584 13:28753222-28753244 TGCCACTGCACTCCAGCCCCTGG + Intergenic
1106496916 13:30286684-30286706 GGCCACCATCCTACAGATCCCGG + Intronic
1106832953 13:33604755-33604777 GGCCACTGCACTCCAGCCCGAGG + Intergenic
1107188397 13:37550075-37550097 GGCCACCATCCTCCAGATCCCGG + Intergenic
1108514664 13:51189061-51189083 CGCCACTGCACTCCAGAGCCTGG + Intergenic
1109098313 13:58145425-58145447 GGCCACTGTCCTCCAGAACCCGG + Intergenic
1109503978 13:63274560-63274582 GGCAACTGCCCTCCAGATTCCGG + Intergenic
1109667563 13:65558985-65559007 GGTCACTGTCCTCCAGACCCTGG - Intergenic
1109810755 13:67509611-67509633 GGCCACCATCCTCCAGACCCCGG + Intergenic
1111064525 13:83072954-83072976 GGCCACCTTCCTCCAGACCCAGG + Intergenic
1111081895 13:83321995-83322017 GGCCACTGTCTTCCAGACCCCGG - Intergenic
1111083520 13:83343191-83343213 TGCCTCTGTCCTCCAGACCCCGG + Intergenic
1111219113 13:85180935-85180957 GACCAGTGTCTTCTAGACCCTGG + Intergenic
1111221356 13:85208757-85208779 GGTCACTGTCCTCCAGACCCTGG + Intergenic
1111419880 13:87998635-87998657 GGCCACCATTCTCCAGACCCTGG + Intergenic
1111442975 13:88304652-88304674 GGCCACCATCCTTTAGACCCTGG + Intergenic
1112118287 13:96381902-96381924 GGCCAGTGTCCTCCTGCCTCAGG - Intronic
1112186570 13:97133606-97133628 GGACACTGTAGGCCAGACCCTGG + Intergenic
1113466798 13:110518753-110518775 GGCCACTGACACCCTGACCCAGG + Intergenic
1113905364 13:113817063-113817085 GGCCACTGTCCCCTGGGCCCGGG - Intergenic
1114273359 14:21119096-21119118 CGCCACTGAACTCCAGAGCCTGG - Intergenic
1114276846 14:21154524-21154546 TGCCACTGTGCTCCAGCCTCGGG + Intergenic
1114680447 14:24479751-24479773 GGCCACTGTCCTCAGACCCCAGG - Intergenic
1114778649 14:25514587-25514609 GGCCATTATCCTCCAGACCCTGG - Intergenic
1115199079 14:30834174-30834196 AGCCACCATCCTCCAGACCCTGG - Intergenic
1115404193 14:32996887-32996909 GGCCACCATCCTCCAGACGCCGG + Intronic
1115916515 14:38321227-38321249 GGCCACCATCCTCCAGATCCTGG - Intergenic
1117268637 14:54117636-54117658 CGGCACTGTGCTTCAGACCCAGG + Intergenic
1117850408 14:59962443-59962465 GGCCACTGCACTCCAGTCTCGGG - Intronic
1118137398 14:63045187-63045209 GGCCGCTGCTCTCCAGACCCAGG - Exonic
1118164839 14:63326144-63326166 TGCCACTGCACTCCAGAGCCTGG - Intergenic
1118242033 14:64069407-64069429 GGCCACTGTCCAAGAGACCTAGG - Intronic
1118770623 14:68940365-68940387 GGCCAGAGTCTGCCAGACCCCGG - Intronic
1118948348 14:70410074-70410096 TGCCACTGTACTCCAGACTGGGG + Intronic
1119182548 14:72614489-72614511 GGCCCCTGTCCCCCAAGCCCAGG - Intergenic
1119299720 14:73561940-73561962 TGCCACTGCACTCCAGAGCCTGG + Intergenic
1120152737 14:81055434-81055456 GGCCACCATCCTCCAGACCCCGG + Intronic
1120185585 14:81390520-81390542 CGCCACTGCACTCCAGAGCCTGG + Intronic
1120469424 14:84903690-84903712 GGTCACCATCCTCTAGACCCCGG + Intergenic
1121484679 14:94305538-94305560 GGCCCCTGACCTCAAGACACAGG - Intronic
1122124159 14:99570289-99570311 GGCCACTGTGAGCCAGGCCCTGG + Intronic
1122208903 14:100162302-100162324 CGCCACTGCACTCCAGAGCCTGG + Intergenic
1122941473 14:104983288-104983310 GGCTAATGTCCCCCACACCCAGG + Intergenic
1123189153 14:106551337-106551359 GGGCACCTTCCTCCAGACCCCGG + Intergenic
1123197373 14:106629515-106629537 GGCTGCTATCCTCCAGACCCTGG + Intergenic
1123198712 14:106641391-106641413 GGCTGCTATCCTCCAGACCCTGG + Intergenic
1202873570 14_GL000225v1_random:188094-188116 GGCCACTGCACTCCAGCCCAGGG - Intergenic
1123958269 15:25364163-25364185 TGCCACTGTACTCCAGGCCTGGG + Intronic
1124787150 15:32692089-32692111 CCCCACTGGCCTACAGACCCTGG - Intronic
1124926172 15:34072688-34072710 GGCCACTGCACTCCAGAGCCTGG - Intergenic
1127680496 15:61291255-61291277 TGCCACTGTACTCCAGCCCGGGG + Intergenic
1127760180 15:62131905-62131927 GGTCACTGTCATCCACACCTGGG + Intergenic
1127807932 15:62538177-62538199 CGCCACTGCACTCCAGAGCCTGG + Intronic
1128225943 15:66001413-66001435 AGCCTCTGTACTCCAGAGCCGGG + Intronic
1128253646 15:66181277-66181299 TGCCACTGCACTCCAGATCCTGG - Intronic
1129447222 15:75626970-75626992 CGCCACTGCACTCCAGAGCCTGG - Intergenic
1129701088 15:77769086-77769108 GGCCTCCCTGCTCCAGACCCTGG + Intronic
1129832922 15:78682343-78682365 GGCCACTGTCCTCACTGCCCTGG + Intronic
1130151106 15:81312385-81312407 GGTCTCTGTCTTCCAGGCCCTGG - Exonic
1130603715 15:85296188-85296210 CGCCACTGCACTCCAGAGCCTGG + Intergenic
1130684374 15:86024009-86024031 GGTCCTTGTCCTCCAGGCCCTGG + Intergenic
1130738209 15:86571896-86571918 TGCCGCTGTTCTCCACACCCAGG + Intronic
1130896574 15:88174722-88174744 GCCCACTCTCCTCCAAAGCCAGG + Intronic
1131101487 15:89693685-89693707 TGCCATTATCCACCAGACCCAGG + Intronic
1131638622 15:94264565-94264587 CGCCACTGCACTCCAGAGCCTGG + Intronic
1132211493 15:100026632-100026654 TGCCATTGTCCCCCAGACCCAGG - Intronic
1132333653 15:101029392-101029414 GCTCACTGTCCTGCTGACCCAGG - Intronic
1132560372 16:590675-590697 TGACACCGTCCCCCAGACCCCGG - Intronic
1132601254 16:774197-774219 AACCAGTGTCCTCCAGGCCCAGG - Exonic
1132672404 16:1107240-1107262 GTCCCCTGACCTGCAGACCCGGG + Intergenic
1132935059 16:2475720-2475742 GGCCGCTGTCCTTCGGGCCCTGG + Intronic
1132998052 16:2834082-2834104 GGCCACTGAACACCAGACCTAGG + Intronic
1133152659 16:3848126-3848148 TGCCACTGCACTCCAGACACTGG + Intronic
1133286362 16:4692654-4692676 GGCCACTTTCCTCCCCACCAGGG - Intergenic
1133322776 16:4924688-4924710 TGCCAGGGTCCTCCACACCCAGG - Intronic
1134184958 16:12077660-12077682 CGCCACTGCACTCCAGCCCCGGG - Intronic
1134193306 16:12139153-12139175 GGCCACTGTACTCCAGAGCCTGG + Intronic
1134270730 16:12730989-12731011 GACCACTGTCCTTCTCACCCTGG + Intronic
1134395453 16:13858419-13858441 TGACACTGTCCTCCAGAACAGGG - Intergenic
1134458555 16:14412391-14412413 GGCCACTGTACTCCAGGCCTGGG - Intergenic
1134527489 16:14955541-14955563 CACCACTGTACTCCAGAGCCTGG - Intergenic
1134605526 16:15568126-15568148 AGGCTCTGTCTTCCAGACCCAGG - Intronic
1135864087 16:26084648-26084670 TGCTACTGTACTCCAGAGCCTGG - Intronic
1135982673 16:27160532-27160554 CACCACTGTACTCCAGAGCCTGG - Intergenic
1136039459 16:27566492-27566514 TGCCACTGCACTCCAGCCCCAGG + Intronic
1136172616 16:28497815-28497837 GGCCTCTGCCCTCCGGCCCCCGG - Exonic
1136401913 16:30023921-30023943 GGCTGCTCTCCTCCAGACCCTGG - Intronic
1136617461 16:31407310-31407332 CGCCACTGCACTCCAGAGCCTGG + Intronic
1137499147 16:48997266-48997288 GGCCACCGTCCTCGATACCATGG + Intergenic
1137513031 16:49117849-49117871 CCCCACTCTCCACCAGACCCAGG + Intergenic
1137668652 16:50266628-50266650 GGCCACCTCCCTGCAGACCCTGG + Intronic
1137714828 16:50592271-50592293 GGCCACTGTCCCCAAGTCACTGG + Intronic
1137757220 16:50912304-50912326 CACCACTGTGCTCCAGCCCCTGG + Intergenic
1138219437 16:55238376-55238398 GGCCACTCTCCTGGAGAGCCCGG - Intergenic
1139591069 16:67933342-67933364 CGCCACTGCACTCCAGAGCCTGG + Intronic
1139673843 16:68509679-68509701 GGCCACTGGTCTGCAGCCCCAGG + Intergenic
1139812993 16:69638335-69638357 GTACACTTTACTCCAGACCCAGG + Intronic
1140316700 16:73905353-73905375 CGCCACTGCACTCCAGAGCCTGG - Intergenic
1142108562 16:88319126-88319148 GGCCACTGTCCTGCGGATTCTGG + Intergenic
1142152081 16:88517072-88517094 GGCCCCTTTCCTCCAACCCCTGG - Intronic
1142174808 16:88640195-88640217 GGGGGCTGTCCTCCAGACACGGG - Exonic
1142341101 16:89523050-89523072 GGCCCCTGTTCTCCAGACATTGG - Intronic
1142590781 17:1004861-1004883 TGCCACGGTCCTCCAGGACCTGG - Exonic
1142611765 17:1112306-1112328 TGCCACTGTCCTCCATCCCCAGG - Intronic
1142753617 17:2002811-2002833 AGCCAGGGTCCTCCATACCCCGG + Intronic
1142770811 17:2095503-2095525 AGGCACTGTCCTCCAGACCCTGG + Intronic
1143018084 17:3902333-3902355 CGCCACTGCACTCCAGACTCGGG - Intronic
1144963323 17:19059336-19059358 GGCCAGTAGCCTCCAGACGCCGG - Intergenic
1144964367 17:19066704-19066726 GGCCAGTAGCCTCCAGACGCCGG + Intergenic
1144971836 17:19115189-19115211 GGCCAGTAGCCTCCAGACGCCGG + Intergenic
1144983599 17:19185440-19185462 GGCCAGTAGCCTCCAGACGCCGG - Intergenic
1144984626 17:19192799-19192821 GGCCAGTAGCCTCCAGACGCCGG + Intergenic
1145025043 17:19461837-19461859 GGCTAATGTCCTCCAGGCCCTGG + Intergenic
1145029566 17:19494421-19494443 GGCCAGTGGGCTCAAGACCCAGG - Intergenic
1145246591 17:21273680-21273702 GGCCAGAGTCCTCCTGGCCCGGG + Intergenic
1145817811 17:27808095-27808117 GGCCACTGTCAGGCAGACTCAGG + Intronic
1145998058 17:29115679-29115701 GGCCACTCTCCTCGGGGCCCTGG + Exonic
1146048148 17:29527421-29527443 TGGCACTGTACTCCAGAGCCTGG + Intronic
1146373971 17:32281877-32281899 TGCCACTGACCTCCAGCTCCAGG - Intronic
1146461617 17:33050386-33050408 GGCCATGGTCATCCAGAGCCAGG - Intronic
1146493271 17:33297778-33297800 TGCCACTGTACTCCAGCCTCGGG + Intronic
1146591519 17:34131752-34131774 GGCCCCTGCCCAGCAGACCCTGG - Intronic
1147320609 17:39643624-39643646 GGCCAACCTCCTCCACACCCAGG + Intronic
1147621027 17:41866810-41866832 TGCCACTGTACTCCAGCCCTGGG + Intergenic
1147685872 17:42286673-42286695 GCCCTCTGCCCTCCAGACCTGGG + Intergenic
1147729627 17:42590327-42590349 TGCCACTGTACTCCAAAACCTGG + Intronic
1147914143 17:43876797-43876819 GGCAACTGTCCTTCAAGCCCAGG + Intronic
1148282523 17:46360034-46360056 GGCCACTGAACTCCAGCCCAGGG + Intronic
1148290775 17:46446715-46446737 TGCCACTGCCCTCCAAAGCCTGG + Intergenic
1148304741 17:46577959-46577981 GGCCACTGAACTCCAGCCCAGGG + Intronic
1148312965 17:46664420-46664442 TGCCACTGCCCTCCAAAGCCTGG + Intronic
1148440459 17:47709182-47709204 GGCCACTCTCCCCAAGCCCCGGG + Exonic
1148743897 17:49907919-49907941 GGACTCTGTCCTCCAGATGCAGG + Intergenic
1148881861 17:50734515-50734537 AGCCACTGTACTCCAGGCCCTGG - Intronic
1149140618 17:53428680-53428702 GGCCACCATATTCCAGACCCTGG + Intergenic
1149899841 17:60464982-60465004 TGCCACTGCACTCCAGACCTTGG + Intronic
1150057193 17:62028801-62028823 CGCCACTGCACTCCAGACCAGGG + Intronic
1150122793 17:62617591-62617613 GGGCACTTCCCTCCACACCCAGG - Intergenic
1150307665 17:64100160-64100182 GGCCACAGTTCTCCAGGCCCAGG - Intronic
1150515766 17:65807931-65807953 GGCCACCATCCTCCAGACCCCGG + Intronic
1150902143 17:69292065-69292087 TGCCACTGTCCTCCAGCCTGGGG + Intronic
1151045709 17:70917493-70917515 GGCCACTATCCTCCAGACTAAGG + Intergenic
1151373560 17:73666609-73666631 GGGCACAGTTCTCCAGGCCCAGG + Intergenic
1152102317 17:78309302-78309324 GCTCAAAGTCCTCCAGACCCAGG + Intergenic
1152292090 17:79445792-79445814 GGGGACTGTCCTGCAAACCCCGG - Intronic
1152296904 17:79472757-79472779 TGCCACTGACCAACAGACCCAGG - Intronic
1152297349 17:79475817-79475839 GGCCAGTGGCCCCCAGAGCCAGG + Intronic
1152378539 17:79930581-79930603 TGCCACGGCCCCCCAGACCCCGG - Intergenic
1152605560 17:81287925-81287947 GGCCACAGCTCTGCAGACCCAGG + Intronic
1152732494 17:81979180-81979202 GGCACGTGTCCTCCAGAACCTGG - Exonic
1152768435 17:82153223-82153245 GGCCCCTCTCCCCCAGCCCCAGG - Intronic
1153220727 18:2858675-2858697 CGCCACTGCACTCCAGAGCCTGG - Intronic
1153251060 18:3122075-3122097 TGCCACTGTACTCCAGCCTCAGG + Intronic
1153556926 18:6324340-6324362 GGCCACTGCCCTCTAGACCCTGG + Intronic
1153948107 18:10034443-10034465 TGCCACTGTACTCCAGTCTCAGG + Intergenic
1154426888 18:14278765-14278787 GGCCACCTTCCTCTAGACCCCGG - Intergenic
1155851725 18:30782824-30782846 GGCCACCATCCTCCAGACCCTGG + Intergenic
1155863394 18:30932892-30932914 TGCCACTGCACTCCAGCCCCTGG + Intergenic
1156265871 18:35488180-35488202 AGCCACCGTCCTTCAGAGCCCGG - Intronic
1157077290 18:44479674-44479696 GGCTACCATCCTCCAGACCCCGG + Intergenic
1157282143 18:46353215-46353237 GTCTACTGTCCACCACACCCTGG - Intronic
1158524356 18:58198844-58198866 CGCCACTGCACTCCAGACCTGGG - Intronic
1158962008 18:62595429-62595451 TGCCACTGCACTCCAGAGCCTGG - Intergenic
1158986751 18:62825500-62825522 TGCCACTGCACTCCAGAGCCTGG - Intronic
1159723154 18:71919196-71919218 GCCCACTCTGCTCCACACCCAGG + Intergenic
1159761265 18:72429849-72429871 GGTCACTGTCCTCCACACCCCGG - Intergenic
1160447393 18:78938118-78938140 TGCCACTGTACTCCAGACTGGGG - Intergenic
1160644068 19:170188-170210 GGCTGCTGTCCTCCAGACCCCGG - Intergenic
1161292181 19:3500502-3500524 TGCCACCGCCCGCCAGACCCGGG + Intronic
1161336004 19:3713755-3713777 TGCCACTGCACTCCAGAGCCTGG - Intronic
1161495538 19:4584112-4584134 TGCCACTGTCCTCCAGGTCAGGG - Intergenic
1161526420 19:4758925-4758947 TGCCACTGCACTCCAGAGCCTGG - Intergenic
1162019914 19:7863684-7863706 GGCCTCAGTTGTCCAGACCCTGG - Exonic
1162425895 19:10595318-10595340 CGCCACTGCACTCCAGCCCCTGG - Intergenic
1163163000 19:15476567-15476589 GGACTCTGTCATCCAGGCCCTGG - Exonic
1163400539 19:17089584-17089606 GGCCACTGACCCCCACCCCCAGG + Intronic
1163640141 19:18457416-18457438 GGCCCCTGACCTGCACACCCAGG + Intronic
1163743529 19:19031659-19031681 TGCCACTGCCCTCCAGACTGGGG + Intronic
1163954793 19:20626971-20626993 CGCCACTGCACTCCAGAGCCTGG + Intronic
1164174253 19:22755027-22755049 TGCCACTGCACTCCAGAGCCTGG + Intergenic
1164225890 19:23245569-23245591 CGCCACTGCACTCCAGACCTGGG + Intronic
1164666538 19:30042570-30042592 GGCCACCATCCTCCAGACCCCGG + Intergenic
1165094676 19:33403585-33403607 GGCCAGGGTCCTCCACCCCCTGG - Intronic
1165192221 19:34074575-34074597 TGCCACTGCCCTCCAGACTGGGG - Intergenic
1165448126 19:35868058-35868080 GCCCATTCTCCTTCAGACCCAGG - Intronic
1165714152 19:38033628-38033650 TGCTACTGTACTCCAGCCCCGGG + Intronic
1165777385 19:38412850-38412872 CCCCAACGTCCTCCAGACCCAGG + Intronic
1165844498 19:38809520-38809542 GGCCACTGTACTCCAGCCTGGGG - Intronic
1166011134 19:39943545-39943567 GGCCCCTGTCCTCCTCCCCCAGG - Intergenic
1166750523 19:45162175-45162197 GGCCACTGTGCTCCCAGCCCGGG - Intronic
1167298775 19:48667343-48667365 GGGCAGTGCCCTCCAAACCCGGG - Intronic
1167779803 19:51591808-51591830 TGCCACTGCACTCCAGAGCCTGG - Exonic
1167875594 19:52409756-52409778 TGCCACTGCACTCCAGCCCCTGG - Intronic
1167908549 19:52682824-52682846 TGCCATTGTACTCCAGACCTGGG + Intronic
1168055530 19:53862567-53862589 CGCCACTGCACTCCAGCCCCTGG - Intergenic
1168220758 19:54958601-54958623 GGCCACTGCACTCCAGCCCAAGG + Intronic
925111865 2:1344316-1344338 TGCCACTGTCCTACAGAGCTGGG - Intronic
925526979 2:4813918-4813940 GGCCACTGTCCTCCAGACCCTGG - Intergenic
926236803 2:11051772-11051794 GGCCACTCTCCTCCTGCCTCAGG - Intergenic
926632580 2:15150031-15150053 TGCCACTGTGCTCCAGAGCCTGG + Intergenic
926738213 2:16090359-16090381 TGCCACTGTCACTCAGACCCAGG - Intergenic
926827288 2:16918924-16918946 CGCCACTGCACTCCAGCCCCGGG + Intergenic
927030545 2:19116727-19116749 GGCTACTGTTCCCCAGATCCTGG - Intergenic
927286284 2:21360409-21360431 CGCCACTGCACTCCAGAGCCTGG - Intergenic
927490351 2:23517158-23517180 AGCCACTCTCCTCCAGCCCGGGG + Intronic
927555989 2:24032458-24032480 CGCCACTGTACTCCAGGACCGGG + Intronic
928286500 2:29994288-29994310 TGCCACTGTACTCCAGTCTCTGG + Intergenic
928400117 2:30971686-30971708 GGCCACTCCTCCCCAGACCCTGG - Intronic
929127859 2:38537277-38537299 TGCCACTGTCCTCCAGCCCGGGG - Intergenic
929170679 2:38929930-38929952 GGCCACTGTGCTCCACAGCTTGG + Intronic
929452152 2:42045206-42045228 GGACACTGGCCTGCAGACTCTGG + Intergenic
929594548 2:43168149-43168171 AGCTTCTGTCCCCCAGACCCTGG + Intergenic
930178356 2:48324235-48324257 TGCCACTGTACTCCAGGCCTGGG - Intronic
930560069 2:52949869-52949891 GGCCACCATCTTCCAGACCCCGG - Intergenic
931800889 2:65756714-65756736 GGCCACTGTCCTCCAGATCCTGG - Intergenic
932041221 2:68301848-68301870 CGCCACTGCACTCCAGAGCCTGG + Intronic
932342836 2:70977460-70977482 GACCACGGTCCGCCAGACCAGGG + Intronic
932537208 2:72611314-72611336 TGCCACTGCACTCCAGTCCCAGG + Intronic
932647339 2:73517293-73517315 CACCACTGTACTCCAGAGCCTGG - Intronic
932731991 2:74227933-74227955 AGCCACTGTCATCCAGAACAGGG - Intronic
933798669 2:85942358-85942380 GGCCACCATCCTCCAGACCCTGG - Intergenic
933906656 2:86900540-86900562 TGCCACTGTACTCCAGCCACAGG + Intergenic
934024817 2:87993095-87993117 TGCCACTGTACTCCAGCCACAGG - Intergenic
934666479 2:96174782-96174804 GGACAGTGGCCTCCAGACACCGG + Intergenic
934858159 2:97741586-97741608 AGCCCCTCTCCTCCATACCCAGG - Intergenic
935444008 2:103137459-103137481 CACCACTGTGCTCCAGAGCCTGG - Intergenic
935775894 2:106471173-106471195 TGCCACTGTACTCCAGCCACAGG - Intergenic
936089068 2:109489317-109489339 AGCCACAGGCCCCCAGACCCTGG + Intronic
936365057 2:111845931-111845953 CGCCACTGCACTCCAGAACCTGG + Intronic
936514949 2:113175476-113175498 GGCCTCTGTCCTGCAGCTCCAGG + Intronic
936651390 2:114430538-114430560 GGCCCCAGTCCTCCAGTTCCTGG - Intergenic
937373900 2:121322143-121322165 TGCCACTGCACTCCATACCCTGG + Intergenic
937436882 2:121888244-121888266 GGCCACTGACCTCAAGAACAAGG + Intergenic
937609181 2:123840018-123840040 GGCCACTCTGCTCCACACCTAGG + Intergenic
938182594 2:129196524-129196546 GCTCACTGTCCTCCAGAAGCTGG + Intergenic
938389544 2:130893994-130894016 GGCCCATCTCCTTCAGACCCTGG - Intronic
938419751 2:131135643-131135665 CGCCACTGCACTCCAGAGCCTGG - Intronic
938461644 2:131501460-131501482 TGCCACTCTCCTCCAGCCCAGGG + Intergenic
940130879 2:150380296-150380318 GGCCACTGCACTCCAGCCCTGGG - Intergenic
940825652 2:158409224-158409246 GGCCACTATCCTCCAGACTCCGG + Intronic
940835028 2:158511342-158511364 CGCCACTGTACTCCAGCCTCGGG + Intronic
941477610 2:165968290-165968312 AGCCACCATCATCCAGACCCTGG + Intergenic
941627896 2:167849846-167849868 CGCCACTGCACTCCAGCCCCGGG + Intergenic
941741928 2:169044450-169044472 GCCCACCATCCTCCAGATCCTGG + Intergenic
941917760 2:170823420-170823442 GGGCTCTGTCCTCTAGACCCTGG + Intronic
942649419 2:178150904-178150926 CGCCACTGTACTCCAGCCCGGGG - Intergenic
943481725 2:188427852-188427874 GGCCTCTGTCCTCTAGACCCTGG + Intronic
944109376 2:196115621-196115643 TGCCACTGTACTCCACAGCCTGG + Intergenic
944371161 2:198985347-198985369 GGCCACCATCTTCCAGACCCTGG - Intergenic
944624641 2:201558791-201558813 GGCCACTGTCCCCCAGAGGAGGG - Intronic
945062475 2:205921326-205921348 GTCCACTTTCATCCAGACCTGGG + Intergenic
945336584 2:208599715-208599737 GGGCACAGTTGTCCAGACCCTGG - Intronic
945429234 2:209745582-209745604 TGCCACTGCCCTCCAGCCTCGGG - Intergenic
945859083 2:215100054-215100076 TGCCACTGTACTCCAGGCCTGGG - Intronic
946006298 2:216527759-216527781 GGCCATTACCCCCCAGACCCAGG + Intronic
946055799 2:216901002-216901024 GGCAACTGTTCTCCAGACCCTGG - Intergenic
946164443 2:217855401-217855423 CCCTACTGTCCTCCAGACTCAGG + Intronic
946699962 2:222402666-222402688 TGCCACTGTACTCCTAACCCCGG - Intergenic
946937469 2:224736757-224736779 GGCTACTATCCTCCAGACCCCGG + Intergenic
947562015 2:231163055-231163077 CGCCACTGCACTCCAGAGCCTGG + Intronic
948131616 2:235604920-235604942 CGCCACTGCCCTCCAGCCCGGGG - Intronic
948281927 2:236753438-236753460 CCTCACTGTCCTTCAGACCCAGG + Intergenic
948367655 2:237468618-237468640 CGCCACTGCACTCCAGAGCCTGG - Intergenic
948392795 2:237624956-237624978 GGCCACCGCCATCCAGACCATGG - Intergenic
948447819 2:238046656-238046678 AGCCACTGCCCTGAAGACCCTGG + Intronic
948506638 2:238432787-238432809 CGCCACTGCACTCCAGAGCCTGG - Intronic
948845482 2:240681048-240681070 GGCCGCTGTCCTGCAGCCCCAGG + Intronic
948848371 2:240693682-240693704 GGCCGCTGTCCTGCAGCCCCAGG - Intronic
948903246 2:240966497-240966519 GGACACTGACCCTCAGACCCAGG - Intronic
1169643043 20:7776711-7776733 GGCCACCGTCCTCCAGACCCTGG + Intergenic
1169857955 20:10124036-10124058 GGCCACCATCCTACAGACCCTGG - Intergenic
1170122056 20:12922586-12922608 GGCCACCATCCTCCAGACCCTGG + Intergenic
1170838672 20:19906405-19906427 TGCCACTGCACTCCAGAGCCTGG + Intronic
1170984415 20:21244723-21244745 GGCCACCAGCCTCCAAACCCTGG + Intronic
1171257493 20:23701196-23701218 GCCCTCTGTACTCCACACCCAGG + Intergenic
1171264907 20:23763355-23763377 GCCCTCTGTACTCCATACCCAGG + Intergenic
1172342727 20:34171326-34171348 CGCCACTGCACTCCAGAGCCCGG - Intergenic
1172707145 20:36890504-36890526 GGCCACTGCACTCCAGCCTCGGG - Exonic
1172789293 20:37491452-37491474 GGACACTGTCCTGCAGTCACTGG - Intergenic
1173302593 20:41817292-41817314 GGCCACTATCATCCAGAGACTGG + Intergenic
1173523527 20:43715963-43715985 GGCCACCGTCTTCCAGGCACTGG - Exonic
1173733220 20:45342574-45342596 TCCCCCTGTCCTCCAGGCCCGGG - Intronic
1174238136 20:49111085-49111107 GGTCACCATCATCCAGACCCAGG + Intergenic
1174811159 20:53647036-53647058 TGCCACTGTACTCCAAACCTGGG - Intergenic
1175733801 20:61371684-61371706 GGCCTCTGTCCTCCAGATGCCGG - Intronic
1177312323 21:19413402-19413424 GGCCACCATCCTCCAGACCTTGG + Intergenic
1177517691 21:22176687-22176709 AGCCACTGTCCTTCAGACCCTGG + Intergenic
1178121234 21:29472593-29472615 TGCCACTGCACTCCAGAGCCTGG - Intronic
1178154181 21:29832293-29832315 GGCCACTGTCCTCCAGACCTCGG - Intronic
1178303653 21:31472637-31472659 GGCCTCTGTGCTCCAGATACTGG + Intronic
1178521372 21:33290645-33290667 AGGCATTGTCCTCCAGCCCCTGG - Intronic
1178809870 21:35871871-35871893 GGCCACCAACCTACAGACCCAGG + Intronic
1178890821 21:36519893-36519915 GGCATCTGTACTCCATACCCTGG - Intronic
1178950128 21:36979228-36979250 CGCCACTGCCCTCCAGGCCTGGG + Intronic
1179235276 21:39540203-39540225 GGCCACCGTCCTCCAGACCCTGG - Intergenic
1180228568 21:46412968-46412990 TGCCGCCGTCCTCCAGACTCAGG - Exonic
1180259589 21:46659754-46659776 GGCCACTGGCTTCCAGTGCCGGG - Intronic
1180284531 22:10731503-10731525 GGCCACTGCACTCCAGCCCGGGG + Intergenic
1180322139 22:11331982-11332004 GATCACTGTCCTCCAGGCCCCGG - Intergenic
1180606727 22:17064599-17064621 GGCCCCTGTCTTCCAGTCTCTGG - Intergenic
1180999384 22:19981005-19981027 GGGCACTGTCCTGCAGGCCCAGG - Intronic
1181342990 22:22197899-22197921 CGCCACTGCACTCCAGAGCCTGG + Intergenic
1181765382 22:25087824-25087846 GCCCCCTCTCCTCCAGACCGTGG - Intronic
1181810346 22:25400304-25400326 GGCCACTGCACTCCAGACTCGGG - Intronic
1182088321 22:27576612-27576634 GGACTCTGTCCCTCAGACCCTGG - Intergenic
1182125279 22:27811361-27811383 GGCCACCGCTCTCCAGACCTGGG + Intergenic
1182137589 22:27919870-27919892 GGCCCTTGGCCTCGAGACCCAGG + Intronic
1182233908 22:28860681-28860703 GGCCACTGCCCTCCAGCCCGGGG - Intergenic
1182349451 22:29691055-29691077 AGCCACTGTCCTCGAGACCCTGG + Intronic
1182555278 22:31125664-31125686 GGCCAGGGTCCTTCAGAGCCTGG + Exonic
1182625829 22:31645361-31645383 TGCCACTGTACTCCAGCCCTAGG + Intronic
1183640724 22:39090822-39090844 GGCCACTTTACTCCTGACCCGGG - Intergenic
1183747528 22:39700188-39700210 GGCCATTGTCCTCTTGTCCCTGG + Intergenic
1184009264 22:41734549-41734571 TGCCACTGTACTCCAGACTGAGG + Intronic
1184113178 22:42407121-42407143 CGCCACTGCACTCCAGCCCCTGG - Intronic
1184239992 22:43206984-43207006 TGCCCTTGTCCTCCACACCCCGG + Intronic
1184452919 22:44593488-44593510 GACACCTGCCCTCCAGACCCTGG + Intergenic
1184959955 22:47921619-47921641 GGCCTCTGCCCTCCAGCCCGGGG + Intergenic
1185044204 22:48520832-48520854 GCCCACTGTCTTTCAGACCCTGG + Intronic
950267276 3:11583704-11583726 GGCCACTGTCTCCCAGAGGCAGG - Intronic
950492812 3:13316493-13316515 GGCCCCTGTGCTCCAGGCCGAGG - Exonic
951246727 3:20349957-20349979 GGCCAGCGTCCTCCCCACCCAGG + Intergenic
953379345 3:42455193-42455215 GGCCACTGTCCTCCAGCCCCCGG - Intergenic
953725266 3:45392343-45392365 CGCCACTGCACTCCAGAGCCTGG - Intronic
953785990 3:45911625-45911647 GCCCCCTGTCCTCCTGACTCAGG - Intronic
953883925 3:46705049-46705071 GGACTGTGTCCTCTAGACCCTGG + Intronic
953972766 3:47359901-47359923 GGCTGCCATCCTCCAGACCCAGG + Intergenic
954157099 3:48691757-48691779 TGCCACTGCACTCCAGAGCCTGG + Intronic
954280796 3:49576240-49576262 GGCCACTGTCCTCCCCAAGCAGG - Intronic
954432486 3:50478276-50478298 GGCCCCTGTCCACCAGGGCCTGG + Intronic
954605530 3:51906352-51906374 GTCTACTGTCCTCCAGACCCCGG + Intergenic
954921925 3:54198704-54198726 TGCCACTGTCCCTCAGGCCCCGG + Intronic
955343375 3:58142828-58142850 GTCCACTGTCCCCCAGACCCAGG + Intronic
955435446 3:58894658-58894680 GGCCACCATCCTCCAAACCCCGG - Intronic
956454122 3:69403939-69403961 TGCCACTGCACTCCAGAGCCCGG - Intronic
956619303 3:71204884-71204906 ATCCACTGTCCTCCTGACCCGGG + Intronic
956671959 3:71699462-71699484 GGACACTTACCCCCAGACCCTGG + Intronic
956911426 3:73821799-73821821 GGCCACCATCCTCTAGACCCCGG + Intergenic
957129827 3:76208785-76208807 TGCCATTATCCCCCAGACCCGGG - Intronic
958018431 3:87969235-87969257 CACCGCTATCCTCCAGACCCTGG + Intergenic
958860281 3:99437367-99437389 AGCCATTGTCCTCCAGACACTGG + Intergenic
958861059 3:99445770-99445792 TGCCATTTTCCTCCAAACCCTGG + Intergenic
958893408 3:99804952-99804974 GGCCACCTTCCTCAAGACTCTGG - Intergenic
959160813 3:102722433-102722455 GGCAACTGGCCTGCAGACCATGG - Intergenic
959319128 3:104848463-104848485 GGCCACCATCCTCCAGACCCTGG + Intergenic
959377095 3:105600789-105600811 CACCACTGTACTCCAGCCCCGGG + Intergenic
959505659 3:107153714-107153736 CTCCACTGTCCTCCAGAACTTGG + Intergenic
959958387 3:112267235-112267257 TGCCACTGTACTCCAGAGCCTGG + Intronic
960150681 3:114245886-114245908 CACCACTGTCCTCCAGACCCTGG + Intergenic
960628303 3:119702896-119702918 CTCCACTCTCCTCCTGACCCTGG + Intergenic
961529809 3:127533544-127533566 GGCCAGTGTCCTCCCATCCCGGG + Intergenic
961537732 3:127580203-127580225 GGCCACTGTCCTCCTTCCCCTGG + Intronic
961830685 3:129621582-129621604 TGCCACTGTCCCCCACCCCCTGG + Intergenic
963255334 3:143139276-143139298 GACCACTCTACGCCAGACCCAGG - Intergenic
963339737 3:144019963-144019985 AGCCACCATCCTCCAGACCCCGG - Intronic
964162252 3:153659483-153659505 CGCCACTGCACTCCAGAGCCTGG + Intergenic
965110858 3:164420415-164420437 GGCCACTGCACTCCAGGCCTGGG - Intergenic
965237122 3:166138457-166138479 TGCCACTGCACTCCAGAGCCTGG - Intergenic
965989619 3:174800642-174800664 GGCCACTGTCTTCCAGACCCTGG + Intronic
966217286 3:177516852-177516874 GCCCACTGACCTGCAGCCCCAGG - Intergenic
966641063 3:182191233-182191255 GGTGACTGACCTCCAGACTCAGG + Intergenic
966681404 3:182645482-182645504 CGCCACTGCACTCCAGAGCCTGG - Intergenic
966913229 3:184570662-184570684 GGGCTGTGTGCTCCAGACCCTGG - Intronic
967132636 3:186486634-186486656 GGCCACTTCCCAGCAGACCCAGG + Intergenic
968149146 3:196323342-196323364 TGCCACTGTACTCCAGACAGGGG + Intronic
968190077 3:196661041-196661063 GGCCACAGCCCTCCAGAGACAGG - Exonic
968354539 3:198094021-198094043 AGCCACCCTCCTCCAGACCCTGG - Intergenic
968423813 4:507479-507501 GGCCAATGTGGTCCAGCCCCAGG - Exonic
968762500 4:2449871-2449893 GCCCAGTGTCCTCCAGGCCATGG - Intronic
968877411 4:3280130-3280152 GGTCACTGTTCTGCAGACACAGG + Intergenic
969313420 4:6367442-6367464 GGACACAGGCCTCCTGACCCTGG + Intronic
969639842 4:8390300-8390322 TGCCACTGTACTCCAGCCTCCGG + Intronic
969656808 4:8503416-8503438 GCCCAGTGTCCTCCACACCTGGG - Intergenic
970294563 4:14614542-14614564 AGCCACTGCACTCCAGAGCCTGG + Intergenic
970443911 4:16108531-16108553 GTCCACTGGCCTCAACACCCTGG + Intergenic
971273623 4:25174609-25174631 CGCCACTGCACTCCAGAACCTGG + Intronic
971741301 4:30525362-30525384 GGCCATCGTCCTCCAGACCCTGG - Intergenic
971977530 4:33710110-33710132 GGCCACTGTCCTCAATGACCCGG - Intergenic
972455890 4:39254784-39254806 GCCCTCTTTCCCCCAGACCCTGG + Intronic
972744605 4:41921108-41921130 GCCCACTATCCTCCAGATCCCGG + Intergenic
972988853 4:44798944-44798966 GAGCACTATCCTCCAGTCCCTGG + Intergenic
974202247 4:58656964-58656986 GGCCACCATCCTCCAGAACCTGG + Intergenic
974600278 4:64070905-64070927 TGCCACTGTCCTAAAGATCCAGG + Intergenic
974679830 4:65146746-65146768 GGCCACCATCCTCCAGACCCCGG - Intergenic
974872528 4:67660728-67660750 TGCCACAGTCCTCCAGATCCCGG + Intronic
975804276 4:78096366-78096388 GGCCACCATCCTCCAGACCCCGG - Intronic
975909295 4:79248620-79248642 GGCCATTGTTCTCCAGGCACAGG - Intronic
975917061 4:79337727-79337749 CGCCACTGCACTCCAGAGCCTGG + Intergenic
976229051 4:82821504-82821526 CGCCACTGCACTCCAGGCCCAGG + Intronic
976963605 4:91009050-91009072 GTCCACTGTGCTCCTGATCCGGG - Intronic
977035359 4:91944182-91944204 CGCCACTGCACTCCAGAGCCTGG + Intergenic
977174834 4:93807457-93807479 GGCTACTTTCCTCCACACCAAGG + Intergenic
977428986 4:96907574-96907596 GACTCCTGTCCTCCAGACTCTGG - Intergenic
978921054 4:114183448-114183470 GGCCCCCATCCTCCAGTCCCCGG + Intergenic
979464619 4:121022103-121022125 AACCACTGTCCTCCAGATCCCGG - Intergenic
979764368 4:124446603-124446625 GGCCACCATCTTCCAGACCTCGG - Intergenic
980396633 4:132223722-132223744 GGCTACCATCCTCCAGACCCTGG + Intergenic
980452632 4:132994732-132994754 GGCCCCTGTCTTCCAGTCCCTGG - Intergenic
982342233 4:154312505-154312527 GGCCACTGCCCTCCAGCCTGGGG + Intronic
982560850 4:156926811-156926833 GGCCACTGTCCTCCAGACCCTGG - Intronic
982843296 4:160219773-160219795 GGCCACTGTCCTCCAAACCCCGG - Intergenic
984026356 4:174547810-174547832 GGCCACCATCCTGCAGACCCTGG + Intergenic
984571890 4:181404561-181404583 GGTCACTGTCCTCCAGACCCCGG - Intergenic
984809118 4:183778617-183778639 GGCCACTGTACTCCAGCCTGGGG - Intergenic
984814061 4:183821063-183821085 TGCCACTGTACTCCAGCCTCTGG + Intergenic
984976578 4:185235827-185235849 GGAGACTGTCCTGCAGACCCTGG + Intronic
985157856 4:187011219-187011241 GGACAGTCTCCTCCAGACTCTGG + Intergenic
985591395 5:767186-767208 GCCCAGGGTCCTCCACACCCTGG - Intergenic
985743727 5:1634783-1634805 GGCCATTGCACTCCAGTCCCGGG + Intergenic
985825503 5:2187924-2187946 GGCCACTGTCTTCCAGCTCCCGG + Intergenic
985825603 5:2188715-2188737 GGCCACTGTCTTCCAGCTTCTGG - Intergenic
986333408 5:6734724-6734746 GAACACTGTCCTCCTGACCTTGG - Intronic
986378950 5:7163442-7163464 GGCCACTGTACTCCAGCCTTGGG - Intergenic
986667351 5:10115089-10115111 AGCCTCTGTCCTCCAGCCCATGG - Intergenic
987231193 5:15895683-15895705 CGCCACTGCACTCCAGAGCCTGG - Intronic
987433587 5:17865590-17865612 GGCTACTATCCTCCAGACTCTGG + Intergenic
987494834 5:18630240-18630262 AGCCACCATCCTCCAGACTCCGG - Intergenic
988185781 5:27859960-27859982 CGCCACTGTCCTCCAGCCTGGGG - Intergenic
988397083 5:30708849-30708871 AACCACTGCCCTCCAGACACTGG + Intergenic
988620324 5:32816325-32816347 GGCCACCATCCTCCAGACCCTGG + Intergenic
988750610 5:34188352-34188374 GGCCACCATCCTCCAGACCCCGG + Intergenic
988973016 5:36488440-36488462 GTCCACTGGACTCCAGTCCCTGG - Intergenic
989347518 5:40446530-40446552 TGCCACTGCACTCCAGAGCCTGG + Intergenic
989632182 5:43496629-43496651 CGCCACTGTACTCCAGCCCTGGG - Intronic
989777220 5:45224572-45224594 GGCCACTGTAATCCAGCCCTGGG - Intergenic
990247303 5:53875547-53875569 TGCCACTGCACTCCAGCCCCAGG + Intergenic
991719124 5:69479502-69479524 TGCCACTGCACTCCAGAGCCTGG - Intergenic
992244899 5:74810706-74810728 TGCCACTGCACTCCAGAGCCTGG + Intronic
992244912 5:74810861-74810883 AGCCACTGCACTCCAGACTCAGG - Intronic
993561701 5:89418065-89418087 GACCATTGTCCTCCAGACCCCGG + Intergenic
993602986 5:89952351-89952373 AGAAACTGTCCTCCAGGCCCAGG + Intergenic
994234214 5:97342644-97342666 GGCCACTGTCCTCCAGATTCCGG - Intergenic
994338813 5:98601146-98601168 GGCCACCATCCTCCAGACCCCGG + Intergenic
994578118 5:101607591-101607613 CACCATTGTCCTCTAGACCCAGG - Intergenic
994689496 5:102999454-102999476 GGCCACCATTCTCCAGACCTTGG - Intronic
995125583 5:108574419-108574441 GTCCACTGTGCTCCTGATCCAGG - Intergenic
995244192 5:109918621-109918643 GGCCCTTGTCCTCCAGACCCTGG + Intergenic
995559415 5:113364533-113364555 GGCCATCATCCTCCAGACCCTGG - Intronic
996736158 5:126760488-126760510 CGCCACTGTACTCCAGCCTCGGG - Intergenic
996908087 5:128624937-128624959 GGGGACTGTCCTCCCGTCCCAGG + Intronic
996943001 5:129032338-129032360 GGCCACAGTTCTTCAGACCTTGG + Intronic
998233273 5:140375452-140375474 TGCCACTGCACTCCAGACACAGG + Intergenic
999996989 5:157101814-157101836 TGCCACTGTACTCCAAACCTGGG - Intronic
1000080208 5:157838162-157838184 TGCCACTGCACTCCAGCCCCTGG - Intronic
1000232359 5:159327969-159327991 AACCACTTTCCTCCAGACCATGG - Intronic
1000374205 5:160564423-160564445 GGCCAGTGTCTTCCAGAGGCTGG + Exonic
1000522864 5:162319185-162319207 GTCCACCATCCTCCAGACCCTGG + Intergenic
1000751066 5:165097416-165097438 GGCTACAGTCCCCCAGATCCTGG - Intergenic
1001577718 5:172774909-172774931 GGACAATGTCCTCCAGACGCAGG - Intergenic
1001632637 5:173187422-173187444 GGCTACTGTCCTCCACATCCAGG - Intergenic
1001799688 5:174532223-174532245 AGCCAAGCTCCTCCAGACCCAGG + Intergenic
1002592377 5:180299634-180299656 GACTTCTGTCCTCCAGGCCCTGG - Intergenic
1002690156 5:181044889-181044911 GGACACTCTCCTCCAGGCCTGGG - Intronic
1002732853 5:181354591-181354613 GGCTGCTGTCCTCCAGACCCCGG + Intergenic
1002751685 6:119513-119535 GGCTGCTGTCCTCCAGACCCCGG - Intergenic
1003203918 6:3990157-3990179 TGCCACTGCACTCCAGAGCCCGG + Intergenic
1003226865 6:4213995-4214017 GGCCATCGTCCTCCAGACCCCGG - Intergenic
1003517684 6:6831327-6831349 CGCCACTGCACTCCAGAGCCTGG - Intergenic
1003892811 6:10578337-10578359 AGCCACTGCACTCCAGCCCCTGG + Intronic
1003964690 6:11241806-11241828 GGCCAATGTCCAGCAGGCCCCGG + Intronic
1005231529 6:23707469-23707491 TGCCACTATCCTACAAACCCTGG - Intergenic
1005853375 6:29839945-29839967 TGCCACTGCACTCCAGCCCCTGG + Intergenic
1006692592 6:35902369-35902391 CGCCACTGCACTCCAGAGCCTGG + Intronic
1006970666 6:38041866-38041888 GGCCACTGTCATCCAGGCTGGGG + Intronic
1007196634 6:40066964-40066986 GGCCACTGTCCTCCAGATCCCGG + Intergenic
1007632489 6:43280351-43280373 GGCCAATGACCTCCAAACCAAGG + Intronic
1007709167 6:43810808-43810830 CCCCACTGTCCTCCATTCCCTGG + Intergenic
1007843044 6:44732235-44732257 TGCCATTACCCTCCAGACCCAGG + Intergenic
1008104629 6:47428582-47428604 GGCCACCACCCTCCAGATCCTGG - Intergenic
1008322496 6:50133940-50133962 CGCCACTGCACTCCAGAGCCTGG + Intergenic
1008332703 6:50262332-50262354 GACCACTGTCCTCCAGACCCTGG - Intergenic
1008678812 6:53849913-53849935 TGCCACTGTACTCCAGACTGGGG + Intronic
1008680631 6:53868261-53868283 GGCCACTGTACTCCAGCCTAAGG - Intronic
1008804326 6:55409490-55409512 AGCCACTGTACTCCAGACTGGGG - Intergenic
1009420164 6:63456186-63456208 CGCCACTGTACTCCAGCCCTGGG + Intergenic
1009652882 6:66499155-66499177 GGCCACAGTCCTTCAGACTCTGG + Intergenic
1010230317 6:73528799-73528821 TGCTGCTGTCCTCCAAACCCAGG - Intergenic
1010549296 6:77201371-77201393 GACCACCATCCTCCAGACCCCGG + Intergenic
1013234374 6:108184148-108184170 TGCCACTGCACTCCAGCCCCAGG + Intronic
1013312215 6:108906521-108906543 CGCCACTGTACTCCAGCCCTGGG - Intronic
1013538337 6:111083931-111083953 TGCCACTGCCCTCCAGCCTCGGG + Intergenic
1013688120 6:112609500-112609522 GGCCACCATCCTCCAGACCCTGG + Intergenic
1014189388 6:118475393-118475415 TGCCACTGTCCTCCAGCCTGGGG - Intronic
1014205421 6:118651233-118651255 GGCCGCTGGCCTCCGGAGCCAGG + Intronic
1015044217 6:128759702-128759724 GGCCACTGGCCTCCAGAGGAGGG - Intergenic
1016256256 6:142109198-142109220 GGCCACTCTCCTCCAGAGCCCGG - Intergenic
1016284930 6:142462564-142462586 GGCCACTGTCCTCCAGATCCTGG - Intergenic
1016614105 6:146027735-146027757 GGCCACGGTCCTCTGGCCCCGGG + Intronic
1016905648 6:149148191-149148213 CCCCAATGTGCTCCAGACCCCGG + Intergenic
1016986395 6:149898906-149898928 GGCCACCGTCCTCCTGGCCAGGG + Intergenic
1016987929 6:149909059-149909081 GGTCACTGTCCTTCAGATTCTGG + Intergenic
1017375480 6:153762784-153762806 GTCAACCATCCTCCAGACCCTGG - Intergenic
1017715940 6:157213255-157213277 GGCCACTGCCCTCCCCAGCCCGG + Intergenic
1017716492 6:157217210-157217232 GGCCACTGCCCTCCCCAGCCCGG - Intergenic
1017771520 6:157648579-157648601 TGCCACTGTCCTCCTGAACTAGG + Intronic
1017849736 6:158294771-158294793 CGCCACTGTGCTCCAGGCCTGGG - Intronic
1018041039 6:159922361-159922383 GGCCACTGTCCTCCAGACCCTGG + Intergenic
1018058355 6:160071136-160071158 GGCCTCTGTGCCCCAGACCCAGG + Intronic
1018419746 6:163631073-163631095 GGCCCCTGTCCTCCTCGCCCCGG + Intergenic
1018527500 6:164729125-164729147 GGCCACTGTCCTCCAGACCCTGG + Intergenic
1018679616 6:166253196-166253218 CGCCACTGCGCTCCAGCCCCGGG + Intergenic
1018709417 6:166486962-166486984 AGACACCGTCCTCCAGCCCCAGG + Intronic
1018783429 6:167089898-167089920 GGCCCCTTTCCTCCAGACATAGG + Intergenic
1018945108 6:168342549-168342571 GGCCACTTTCCTCCTGATCAAGG + Intergenic
1019237107 6:170626909-170626931 GGCTGCTGTCCTCCAGACCCCGG + Intergenic
1019398595 7:837124-837146 GCCCACTGTCCTGCTGCCCCAGG - Intronic
1019442202 7:1053086-1053108 GGCCATTGTTCTCCAGTTCCAGG + Intronic
1019587675 7:1813999-1814021 GGCCCCTGACCTCCAGCCTCTGG + Intergenic
1020063559 7:5170372-5170394 GGCCTCTGTCCTCCAGGTGCCGG + Intergenic
1020420595 7:7999859-7999881 TGCCACTGTCCTCTAGCCCTGGG + Intronic
1021376125 7:19908876-19908898 TGCCACTGTACTCCAGCCTCGGG + Intergenic
1021477872 7:21083116-21083138 TGCCACTGCACTCCAGAGCCTGG - Intergenic
1021519713 7:21527034-21527056 GGCCACTGTCCTCCAGATCCTGG + Intergenic
1021845079 7:24756566-24756588 GGTCGCTGTCCTCGAGACGCAGG - Intronic
1022735311 7:33070590-33070612 GGTCACCATCCTCCAGACCCTGG + Intergenic
1023040738 7:36170961-36170983 GGCCACTGTACTCCACAGCCTGG - Intronic
1024111902 7:46155470-46155492 GTCCCCTGCCCTCCAGCCCCTGG + Intergenic
1024416026 7:49108004-49108026 GGCCACCGTCCTCCAGTCCCCGG + Intergenic
1026059093 7:67010355-67010377 CACCACTGTACTCCAGAGCCTGG - Intronic
1026902123 7:74043183-74043205 GCCCTCTGTCCTCCAGCCCCAGG - Intronic
1027180339 7:75935016-75935038 GGCCACTGTCCTCCAGACCCCGG + Intronic
1028663782 7:93316484-93316506 GGCCACTGCCATCCATATCCAGG - Intronic
1028668320 7:93372229-93372251 GGCCACCATCCCCCAGACCCCGG - Intergenic
1028745268 7:94320284-94320306 GGCCACTGTCCTCCAGACCCTGG - Intergenic
1029070459 7:97891899-97891921 GGCCACCATCCTCCAGACCTCGG - Intergenic
1029155237 7:98512698-98512720 GGGCACTGGCATGCAGACCCCGG + Intergenic
1029236685 7:99125702-99125724 GGCCACTTGCCTCCAGCACCTGG + Intronic
1029710804 7:102298619-102298641 GGCCACTGTACTCCAGCCTGGGG - Intronic
1030128876 7:106179994-106180016 GGCAACTGTCCTGCAGACTGAGG + Intergenic
1030311424 7:108073045-108073067 TGCCACTGTACTCCAGGCCTGGG - Intronic
1032584237 7:133131778-133131800 GGCCTCTGTCCACCAGACTGAGG + Intergenic
1032787021 7:135208935-135208957 GGCCACGGAACTCCAGAACCAGG - Exonic
1033185141 7:139220541-139220563 TGCCACTGCCCTCCAGGCCTGGG - Intergenic
1034443961 7:151102212-151102234 GGCCGCTGTCCTCGTGCCCCAGG - Intronic
1035492280 7:159290854-159290876 AGGGACTGTGCTCCAGACCCAGG - Intergenic
1035510662 8:179699-179721 GGCTGCTGTCCTCCAGACCCCGG - Intergenic
1035721519 8:1796744-1796766 GGCCCCTTTCCTCCAGATCTGGG - Intergenic
1036239668 8:7071257-7071279 AGCCACAGTCCTCCAGGCGCCGG - Intergenic
1037117858 8:15247498-15247520 GGCCATTGTCCTCCAGACCCCGG + Intergenic
1037262292 8:17022659-17022681 TGCCACTGCACTCCAGCCCCTGG - Intergenic
1037904427 8:22707115-22707137 GGCCAGTTTCCCCCAAACCCAGG - Intergenic
1037910558 8:22741377-22741399 TGCCACTGTCTGCCAGGCCCAGG + Intronic
1038110939 8:24496425-24496447 GGCCAATGTCCTCCAGACCCTGG + Intronic
1038286387 8:26209615-26209637 GGGCACTGTTCAGCAGACCCTGG - Intergenic
1038335920 8:26645357-26645379 GGCCACTGAACTCCAGACTGGGG + Intronic
1038490156 8:27965047-27965069 GGCCCCTGTCCTCTGGTCCCAGG + Intronic
1038495261 8:27997171-27997193 GTCCCCTGTCCTCCAGCCCCTGG + Intergenic
1038604215 8:28982487-28982509 GGCCACTGCACTCCAGCCTCGGG - Intronic
1038836916 8:31136039-31136061 TGCCACTGTACTCCAGAGCCTGG - Intronic
1039988003 8:42464147-42464169 TGCCACTGCACTCCAGCCCCTGG - Intronic
1040287195 8:46106469-46106491 AGGCACTGTGCTCCAGATCCTGG + Intergenic
1040530668 8:48264052-48264074 GGCCTCTGTCCACCTGACCTGGG - Intergenic
1040813452 8:51482015-51482037 GGCCAACGTCCTCCAGATCCCGG + Intronic
1042072294 8:64949375-64949397 GGCTACTGTCCTCCAGAACCTGG - Intergenic
1042289909 8:67159562-67159584 TGCCACTGCACTCCAGAGCCTGG - Intronic
1042890072 8:73599807-73599829 CGCCACTGCACTCCAGAACCTGG - Intronic
1043518588 8:81019804-81019826 GGCCACTGTCCTCCAGACCCTGG + Intronic
1045207453 8:100056892-100056914 GGCCACCATCCTCCAGACCCCGG + Intronic
1045966029 8:108025564-108025586 TGCCACTGTACTCCAGCCACAGG - Intronic
1046243731 8:111531959-111531981 GTCCACCGTCCTTTAGACCCAGG - Intergenic
1046405908 8:113771898-113771920 GGCCACTGCACTGCAGAGCCTGG - Intergenic
1046433099 8:114153660-114153682 GGCCACCATCCTCCAGACCCCGG - Intergenic
1046759500 8:118006860-118006882 GGCCACGGTCCTCCAGAGCTAGG - Intronic
1047536583 8:125725638-125725660 AGCCACTTTCCTTCAGAGCCAGG + Intergenic
1047946679 8:129887526-129887548 GGCCACCATGCTCCAGACCCCGG + Intronic
1047961870 8:130016775-130016797 GGCCCGTGTCCTCCCGAGCCGGG + Intronic
1049245740 8:141561355-141561377 GGCCACTGTCCTCCAGATGAAGG + Intergenic
1049433693 8:142576666-142576688 GGGCCCTGTCCTCCTGTCCCTGG - Intergenic
1049589252 8:143448703-143448725 GGCCACTGTCCTCCAGACCCTGG - Intronic
1049617253 8:143581053-143581075 GGCCACGGCCCCACAGACCCAGG - Exonic
1049676476 8:143891491-143891513 AGCCACTGTCCTCTAAGCCCTGG + Intergenic
1049741068 8:144241146-144241168 TGCCACCGTCCTCCAGCCCTGGG - Intronic
1053069714 9:35093965-35093987 GGCCACAGTGGTCCACACCCAGG + Exonic
1053266131 9:36714777-36714799 GGCCAGCCACCTCCAGACCCGGG + Intergenic
1053394748 9:37763098-37763120 AGCCACTGCACTCCAGAGCCTGG + Intronic
1053566355 9:39256752-39256774 TGCCACTGTACTCCAAACCTGGG + Intronic
1053666460 9:40321237-40321259 GGCCACCATCCTCCAGATCCCGG - Intronic
1053746138 9:41199603-41199625 GGCCACTGTTCTTTAGACCCTGG - Intergenic
1053832135 9:42094612-42094634 TGCCACTGTACTCCAAACCTGGG + Intronic
1054130793 9:61362260-61362282 TGCCACTGTACTCCAAACCTGGG - Intergenic
1054377612 9:64461265-64461287 GGCCACCATCCTCCAGATCCCGG - Intergenic
1054481132 9:65665614-65665636 GGCCACTGTTCTTTAGACCCTGG + Intergenic
1054518149 9:66055046-66055068 GGCCACCATCCTCCAGATCCCGG + Intergenic
1054598410 9:67092812-67092834 TGCCACTGTACTCCAAACCTGGG - Intergenic
1054682207 9:68231677-68231699 GGCCACTGTTCTTTAGACCCTGG + Intergenic
1054816938 9:69484439-69484461 GACCACTTCCCTGCAGACCCCGG + Intronic
1055782391 9:79833408-79833430 TGCCACTGCACTCCAGAGCCTGG - Intergenic
1056081797 9:83102740-83102762 GGCCCCTGTGCCCCAGAGCCTGG - Intergenic
1056869891 9:90267768-90267790 GGCCACTCTCCAGCAGGCCCAGG + Intergenic
1057040441 9:91843956-91843978 GGCCACTTTCCTGCAGAGCGGGG + Intronic
1057130613 9:92651755-92651777 CGCCACTGTACTCCAACCCCAGG - Intronic
1057325676 9:94061390-94061412 GGCCACTGTCTTCCAGACCCTGG - Intronic
1057397129 9:94690132-94690154 GGCTTCTGTCCTCCAGAACTGGG + Intergenic
1057496185 9:95563460-95563482 AGCCACTTTCTTCCAGCCCCCGG + Intergenic
1057573587 9:96221910-96221932 CAGCACTGTCCTCCACACCCAGG + Intergenic
1058073622 9:100627676-100627698 GGCCACTGTACTCCAGCCTGGGG - Intergenic
1058101833 9:100925168-100925190 GGCTACCGTCCTCCAAACCCTGG + Intergenic
1058722030 9:107773033-107773055 GTCCACAATCCTCCAGACCGCGG - Intergenic
1058810052 9:108630615-108630637 GGCCACCATCCTCCAGACCCCGG + Intergenic
1059282185 9:113144450-113144472 TGCCACTGCACTCCAGCCCCTGG - Intergenic
1059494150 9:114695694-114695716 TGCCACTGCACTCCAGAGCCTGG - Intergenic
1059531450 9:115039191-115039213 GACCACCGGCCTCCAGAGCCTGG - Intronic
1059664629 9:116434832-116434854 GGCCAGTGTCCCCCAGAGCCTGG - Intronic
1059871890 9:118587049-118587071 GGCCACCATCCTCCAGACCCCGG + Intergenic
1060219592 9:121757274-121757296 AGCCACTGTCCCCAAGACCCTGG - Intronic
1060295577 9:122340819-122340841 AGCTACTGTACTCCAGGCCCTGG - Intergenic
1062518383 9:136947213-136947235 GGCCATTGTCCTGCAGCCCCCGG + Intronic
1062559322 9:137133007-137133029 GGCCACTGCACTCCAGCCCTGGG + Intergenic
1062740039 9:138166965-138166987 GATCACTGTCCTCCAGACCCTGG + Intergenic
1062757260 9:138306917-138306939 GGCTGCTGTCCTCCAGACCCCGG + Intergenic
1202782268 9_KI270718v1_random:10376-10398 GGCCACTGTTCTTTAGACCCTGG - Intergenic
1203730887 Un_GL000216v2:88443-88465 GGCCACTGCACTCCAGCCCAGGG + Intergenic
1187310900 X:18141396-18141418 GGCCTTTGGGCTCCAGACCCTGG - Intergenic
1187521910 X:20021464-20021486 GGCCGCTGTGTTCCAGCCCCAGG + Intronic
1188781835 X:34295206-34295228 GGCCACCATCCTGCAGAACCCGG + Intergenic
1188863408 X:35285493-35285515 GACCACTGTCCCGCAGACCCCGG - Intergenic
1189011383 X:37048951-37048973 GGCCACCATCGTCCAGACCTTGG + Intergenic
1189213400 X:39303377-39303399 GGTCATGATCCTCCAGACCCTGG + Intergenic
1189866513 X:45335606-45335628 CTCCACTGTGCTCCATACCCAGG + Intergenic
1191096801 X:56681480-56681502 GGCCACTGTCCTCCAGACAGCGG + Intergenic
1191987704 X:67000510-67000532 GGCCACTGTCCTCCAGACCCTGG - Intergenic
1192072660 X:67957710-67957732 GGCAACTCTCATCCAGCCCCAGG + Intergenic
1192190084 X:68985700-68985722 GGCCTCTGGCCTCCAGGCTCTGG - Intergenic
1192586374 X:72321658-72321680 CGCCACTGCACTCCAGAGCCCGG - Intergenic
1193442315 X:81557317-81557339 TGTGACTGTCCTTCAGACCCTGG - Intergenic
1193686265 X:84580366-84580388 GGCCATCGTTCTCCAGACACTGG + Intergenic
1193850525 X:86531775-86531797 GGCCACCATCCTCCAGAACCTGG + Intronic
1193865032 X:86720695-86720717 GGCCACTGTTTTCCAGACCATGG - Intronic
1194178833 X:90688348-90688370 GGCCACCATCTTCCAGAACCTGG - Intergenic
1194206265 X:91015208-91015230 AACCACTGTCTTCCAGATCCTGG - Intergenic
1194206482 X:91017059-91017081 GACCACTGTCTTCCAGACCCTGG + Intergenic
1194339780 X:92693985-92694007 GGCCACTGTTCTCCAGACCCCGG - Intergenic
1194388975 X:93292811-93292833 GCCACCTGTCCTCCAGCCCCAGG + Intergenic
1194895314 X:99432756-99432778 GGCCATTGTCCTCCAGACTCCGG + Intergenic
1195035136 X:100965428-100965450 GGTCACCATCCTCCAGATCCTGG + Intergenic
1195665898 X:107429991-107430013 TGCCACTGCACTCCAGAGCCTGG + Intergenic
1196089339 X:111723193-111723215 TGCCACTGCACTCCAGAGCCTGG - Intronic
1196223523 X:113139162-113139184 GGCCACCATCCTCCAGACCCTGG - Intergenic
1196518284 X:116640221-116640243 GGCCACCATCCTCCAGACCCAGG - Intergenic
1196791294 X:119467665-119467687 TGCCACCGTGCCCCAGACCCTGG - Intergenic
1196908708 X:120464791-120464813 TGCCACTGTCCTCCAGCCTGGGG - Intronic
1196973847 X:121137753-121137775 TGCTACCGTCCTCCAAACCCGGG - Intergenic
1197366737 X:125572846-125572868 GGCTACTGTCCTCCAGCTTCTGG - Intergenic
1197581936 X:128294485-128294507 GGCCACCATTCTCCAGACTCCGG + Intergenic
1197856558 X:130919405-130919427 GGCCATCATCCTCCAGACCCGGG - Intergenic
1198612551 X:138418126-138418148 AGCCACCGTCCTCCACACCCTGG + Intergenic
1198966916 X:142237194-142237216 GGCCACTGTCCTCCAGATCCTGG + Intergenic
1199185445 X:144910467-144910489 GGCCACCATCCTCCAGAACCCGG - Intergenic
1200106479 X:153716122-153716144 AGCCACTGCACTCCAGACCGGGG + Intronic
1200296496 X:154925400-154925422 GGCCACCGTCCTCCAGACCCCGG + Intronic
1200525498 Y:4270518-4270540 GGCCACCATCTTCCAGAACCTGG - Intergenic
1200552019 Y:4590029-4590051 GACCACTGTCTTCCAGATCGTGG - Intergenic
1200552234 Y:4591880-4591902 GACCACTGTCTTCCTGACCCTGG + Intergenic
1202590817 Y:26481391-26481413 TGCCACTGTACTCCAGCCCCTGG - Intergenic