ID: 1018527502

View in Genome Browser
Species Human (GRCh38)
Location 6:164729129-164729151
Sequence ACTGTCCTCCAGACCCTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018527493_1018527502 20 Left 1018527493 6:164729086-164729108 CCTTCACTGAGGCACTGCCTAGT No data
Right 1018527502 6:164729129-164729151 ACTGTCCTCCAGACCCTGGATGG No data
1018527492_1018527502 30 Left 1018527492 6:164729076-164729098 CCACACAGAGCCTTCACTGAGGC No data
Right 1018527502 6:164729129-164729151 ACTGTCCTCCAGACCCTGGATGG No data
1018527497_1018527502 3 Left 1018527497 6:164729103-164729125 CCTAGTGGAGCTGTGGGAAGAGG 0: 37
1: 1650
2: 2179
3: 1703
4: 1309
Right 1018527502 6:164729129-164729151 ACTGTCCTCCAGACCCTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018527502 Original CRISPR ACTGTCCTCCAGACCCTGGA TGG Intergenic
No off target data available for this crispr