ID: 1018529032

View in Genome Browser
Species Human (GRCh38)
Location 6:164743465-164743487
Sequence TTTTTATCTTATTGATACCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018529032_1018529043 28 Left 1018529032 6:164743465-164743487 CCATGGTATCAATAAGATAAAAA No data
Right 1018529043 6:164743516-164743538 TGTGAAAGGGGAGTAGAAAGGGG No data
1018529032_1018529037 15 Left 1018529032 6:164743465-164743487 CCATGGTATCAATAAGATAAAAA No data
Right 1018529037 6:164743503-164743525 ATAACATGCCCAATGTGAAAGGG No data
1018529032_1018529042 27 Left 1018529032 6:164743465-164743487 CCATGGTATCAATAAGATAAAAA No data
Right 1018529042 6:164743515-164743537 ATGTGAAAGGGGAGTAGAAAGGG No data
1018529032_1018529041 26 Left 1018529032 6:164743465-164743487 CCATGGTATCAATAAGATAAAAA No data
Right 1018529041 6:164743514-164743536 AATGTGAAAGGGGAGTAGAAAGG No data
1018529032_1018529038 16 Left 1018529032 6:164743465-164743487 CCATGGTATCAATAAGATAAAAA No data
Right 1018529038 6:164743504-164743526 TAACATGCCCAATGTGAAAGGGG No data
1018529032_1018529036 14 Left 1018529032 6:164743465-164743487 CCATGGTATCAATAAGATAAAAA No data
Right 1018529036 6:164743502-164743524 CATAACATGCCCAATGTGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018529032 Original CRISPR TTTTTATCTTATTGATACCA TGG (reversed) Intergenic
No off target data available for this crispr