ID: 1018529034

View in Genome Browser
Species Human (GRCh38)
Location 6:164743500-164743522
Sequence TTTCACATTGGGCATGTTAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018529034_1018529046 26 Left 1018529034 6:164743500-164743522 CCCATAACATGCCCAATGTGAAA No data
Right 1018529046 6:164743549-164743571 AGAACCCTCTATTCAGGAAAGGG No data
1018529034_1018529048 28 Left 1018529034 6:164743500-164743522 CCCATAACATGCCCAATGTGAAA No data
Right 1018529048 6:164743551-164743573 AACCCTCTATTCAGGAAAGGGGG No data
1018529034_1018529044 20 Left 1018529034 6:164743500-164743522 CCCATAACATGCCCAATGTGAAA No data
Right 1018529044 6:164743543-164743565 CTTTAGAGAACCCTCTATTCAGG No data
1018529034_1018529042 -8 Left 1018529034 6:164743500-164743522 CCCATAACATGCCCAATGTGAAA No data
Right 1018529042 6:164743515-164743537 ATGTGAAAGGGGAGTAGAAAGGG No data
1018529034_1018529041 -9 Left 1018529034 6:164743500-164743522 CCCATAACATGCCCAATGTGAAA No data
Right 1018529041 6:164743514-164743536 AATGTGAAAGGGGAGTAGAAAGG No data
1018529034_1018529047 27 Left 1018529034 6:164743500-164743522 CCCATAACATGCCCAATGTGAAA No data
Right 1018529047 6:164743550-164743572 GAACCCTCTATTCAGGAAAGGGG No data
1018529034_1018529045 25 Left 1018529034 6:164743500-164743522 CCCATAACATGCCCAATGTGAAA No data
Right 1018529045 6:164743548-164743570 GAGAACCCTCTATTCAGGAAAGG No data
1018529034_1018529043 -7 Left 1018529034 6:164743500-164743522 CCCATAACATGCCCAATGTGAAA No data
Right 1018529043 6:164743516-164743538 TGTGAAAGGGGAGTAGAAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018529034 Original CRISPR TTTCACATTGGGCATGTTAT GGG (reversed) Intergenic
No off target data available for this crispr