ID: 1018529038

View in Genome Browser
Species Human (GRCh38)
Location 6:164743504-164743526
Sequence TAACATGCCCAATGTGAAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018529032_1018529038 16 Left 1018529032 6:164743465-164743487 CCATGGTATCAATAAGATAAAAA No data
Right 1018529038 6:164743504-164743526 TAACATGCCCAATGTGAAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018529038 Original CRISPR TAACATGCCCAATGTGAAAG GGG Intergenic
No off target data available for this crispr