ID: 1018533477

View in Genome Browser
Species Human (GRCh38)
Location 6:164793747-164793769
Sequence GAATGACTTTGTTTCCTCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018533477_1018533482 8 Left 1018533477 6:164793747-164793769 CCTGGGAGGAAACAAAGTCATTC No data
Right 1018533482 6:164793778-164793800 AGTGGTCTGAAGAAGTTTATGGG No data
1018533477_1018533483 9 Left 1018533477 6:164793747-164793769 CCTGGGAGGAAACAAAGTCATTC No data
Right 1018533483 6:164793779-164793801 GTGGTCTGAAGAAGTTTATGGGG No data
1018533477_1018533480 -10 Left 1018533477 6:164793747-164793769 CCTGGGAGGAAACAAAGTCATTC No data
Right 1018533480 6:164793760-164793782 AAAGTCATTCGAGGGAGCAGTGG No data
1018533477_1018533481 7 Left 1018533477 6:164793747-164793769 CCTGGGAGGAAACAAAGTCATTC No data
Right 1018533481 6:164793777-164793799 CAGTGGTCTGAAGAAGTTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018533477 Original CRISPR GAATGACTTTGTTTCCTCCC AGG (reversed) Intergenic
No off target data available for this crispr