ID: 1018533481

View in Genome Browser
Species Human (GRCh38)
Location 6:164793777-164793799
Sequence CAGTGGTCTGAAGAAGTTTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018533477_1018533481 7 Left 1018533477 6:164793747-164793769 CCTGGGAGGAAACAAAGTCATTC No data
Right 1018533481 6:164793777-164793799 CAGTGGTCTGAAGAAGTTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018533481 Original CRISPR CAGTGGTCTGAAGAAGTTTA TGG Intergenic
No off target data available for this crispr