ID: 1018533482

View in Genome Browser
Species Human (GRCh38)
Location 6:164793778-164793800
Sequence AGTGGTCTGAAGAAGTTTAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018533477_1018533482 8 Left 1018533477 6:164793747-164793769 CCTGGGAGGAAACAAAGTCATTC No data
Right 1018533482 6:164793778-164793800 AGTGGTCTGAAGAAGTTTATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018533482 Original CRISPR AGTGGTCTGAAGAAGTTTAT GGG Intergenic
No off target data available for this crispr