ID: 1018535030

View in Genome Browser
Species Human (GRCh38)
Location 6:164810484-164810506
Sequence GACCACTCTTGGCCTGTTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018535030_1018535036 16 Left 1018535030 6:164810484-164810506 CCAGTAACAGGCCAAGAGTGGTC No data
Right 1018535036 6:164810523-164810545 GTTATATACAGAAGATGGCAGGG No data
1018535030_1018535034 11 Left 1018535030 6:164810484-164810506 CCAGTAACAGGCCAAGAGTGGTC No data
Right 1018535034 6:164810518-164810540 CAGTGGTTATATACAGAAGATGG No data
1018535030_1018535033 -6 Left 1018535030 6:164810484-164810506 CCAGTAACAGGCCAAGAGTGGTC No data
Right 1018535033 6:164810501-164810523 GTGGTCTCTCTAAAGGACAGTGG No data
1018535030_1018535035 15 Left 1018535030 6:164810484-164810506 CCAGTAACAGGCCAAGAGTGGTC No data
Right 1018535035 6:164810522-164810544 GGTTATATACAGAAGATGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018535030 Original CRISPR GACCACTCTTGGCCTGTTAC TGG (reversed) Intergenic
No off target data available for this crispr