ID: 1018535035

View in Genome Browser
Species Human (GRCh38)
Location 6:164810522-164810544
Sequence GGTTATATACAGAAGATGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018535027_1018535035 22 Left 1018535027 6:164810477-164810499 CCAAAGCCCAGTAACAGGCCAAG 0: 169
1: 171
2: 103
3: 76
4: 232
Right 1018535035 6:164810522-164810544 GGTTATATACAGAAGATGGCAGG No data
1018535029_1018535035 16 Left 1018535029 6:164810483-164810505 CCCAGTAACAGGCCAAGAGTGGT No data
Right 1018535035 6:164810522-164810544 GGTTATATACAGAAGATGGCAGG No data
1018535030_1018535035 15 Left 1018535030 6:164810484-164810506 CCAGTAACAGGCCAAGAGTGGTC No data
Right 1018535035 6:164810522-164810544 GGTTATATACAGAAGATGGCAGG No data
1018535032_1018535035 4 Left 1018535032 6:164810495-164810517 CCAAGAGTGGTCTCTCTAAAGGA No data
Right 1018535035 6:164810522-164810544 GGTTATATACAGAAGATGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018535035 Original CRISPR GGTTATATACAGAAGATGGC AGG Intergenic
No off target data available for this crispr