ID: 1018538355

View in Genome Browser
Species Human (GRCh38)
Location 6:164848619-164848641
Sequence CTTGCATTACACATTTATAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018538353_1018538355 4 Left 1018538353 6:164848592-164848614 CCCTCATAGCAGAAGTGAAACAG No data
Right 1018538355 6:164848619-164848641 CTTGCATTACACATTTATATTGG No data
1018538351_1018538355 28 Left 1018538351 6:164848568-164848590 CCAGAGGATTTGCTGCAAACTAG No data
Right 1018538355 6:164848619-164848641 CTTGCATTACACATTTATATTGG No data
1018538354_1018538355 3 Left 1018538354 6:164848593-164848615 CCTCATAGCAGAAGTGAAACAGT No data
Right 1018538355 6:164848619-164848641 CTTGCATTACACATTTATATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018538355 Original CRISPR CTTGCATTACACATTTATAT TGG Intergenic
No off target data available for this crispr