ID: 1018540148

View in Genome Browser
Species Human (GRCh38)
Location 6:164870841-164870863
Sequence TTCACCTGTTATGCTTAATG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018540147_1018540148 -6 Left 1018540147 6:164870824-164870846 CCACAATAACATGATTGTTCACC No data
Right 1018540148 6:164870841-164870863 TTCACCTGTTATGCTTAATGAGG No data
1018540146_1018540148 -5 Left 1018540146 6:164870823-164870845 CCCACAATAACATGATTGTTCAC No data
Right 1018540148 6:164870841-164870863 TTCACCTGTTATGCTTAATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018540148 Original CRISPR TTCACCTGTTATGCTTAATG AGG Intergenic
No off target data available for this crispr