ID: 1018540328

View in Genome Browser
Species Human (GRCh38)
Location 6:164872895-164872917
Sequence ATAGTTTCCCAGGAGTGAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018540328_1018540333 12 Left 1018540328 6:164872895-164872917 CCAGCTCACTCCTGGGAAACTAT No data
Right 1018540333 6:164872930-164872952 CTCTCCATGGCATATCCAATGGG No data
1018540328_1018540332 11 Left 1018540328 6:164872895-164872917 CCAGCTCACTCCTGGGAAACTAT No data
Right 1018540332 6:164872929-164872951 ACTCTCCATGGCATATCCAATGG No data
1018540328_1018540330 -1 Left 1018540328 6:164872895-164872917 CCAGCTCACTCCTGGGAAACTAT No data
Right 1018540330 6:164872917-164872939 TTTCTGCTCCTTACTCTCCATGG No data
1018540328_1018540334 13 Left 1018540328 6:164872895-164872917 CCAGCTCACTCCTGGGAAACTAT No data
Right 1018540334 6:164872931-164872953 TCTCCATGGCATATCCAATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018540328 Original CRISPR ATAGTTTCCCAGGAGTGAGC TGG (reversed) Intergenic
No off target data available for this crispr