ID: 1018549666

View in Genome Browser
Species Human (GRCh38)
Location 6:164981303-164981325
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018549662_1018549666 8 Left 1018549662 6:164981272-164981294 CCTTGAAAGATGAGAAAGAAACA No data
Right 1018549666 6:164981303-164981325 CAGAGCAGAGAGAAGGGGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018549666 Original CRISPR CAGAGCAGAGAGAAGGGGAA AGG Intergenic
No off target data available for this crispr