ID: 1018549716

View in Genome Browser
Species Human (GRCh38)
Location 6:164981782-164981804
Sequence CTGTGTTTGTACAGGGTAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018549716_1018549721 10 Left 1018549716 6:164981782-164981804 CCTTCTACCCTGTACAAACACAG No data
Right 1018549721 6:164981815-164981837 TCATCTATGATCCAGGAGAAAGG No data
1018549716_1018549720 3 Left 1018549716 6:164981782-164981804 CCTTCTACCCTGTACAAACACAG No data
Right 1018549720 6:164981808-164981830 GAAGGTGTCATCTATGATCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018549716 Original CRISPR CTGTGTTTGTACAGGGTAGA AGG (reversed) Intergenic
No off target data available for this crispr