ID: 1018550737

View in Genome Browser
Species Human (GRCh38)
Location 6:164995637-164995659
Sequence GGTTCTCTATGCTGGTCCAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018550737_1018550742 23 Left 1018550737 6:164995637-164995659 CCAATGGACCAGCATAGAGAACC No data
Right 1018550742 6:164995683-164995705 AGCCAATTAATTTTTAACAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018550737 Original CRISPR GGTTCTCTATGCTGGTCCAT TGG (reversed) Intergenic