ID: 1018551301

View in Genome Browser
Species Human (GRCh38)
Location 6:165001699-165001721
Sequence CTCGGGCTGCGCAGTAGCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018551292_1018551301 17 Left 1018551292 6:165001659-165001681 CCAGTCGCCGTGGATCAGGGGGC No data
Right 1018551301 6:165001699-165001721 CTCGGGCTGCGCAGTAGCCCAGG No data
1018551294_1018551301 10 Left 1018551294 6:165001666-165001688 CCGTGGATCAGGGGGCGGCGCTC No data
Right 1018551301 6:165001699-165001721 CTCGGGCTGCGCAGTAGCCCAGG No data
1018551287_1018551301 25 Left 1018551287 6:165001651-165001673 CCATGGGACCAGTCGCCGTGGAT No data
Right 1018551301 6:165001699-165001721 CTCGGGCTGCGCAGTAGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018551301 Original CRISPR CTCGGGCTGCGCAGTAGCCC AGG Intergenic
No off target data available for this crispr