ID: 1018551343

View in Genome Browser
Species Human (GRCh38)
Location 6:165001865-165001887
Sequence GCAGTGAGGGGCTTAGTACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1976
Summary {0: 11, 1: 569, 2: 664, 3: 424, 4: 308}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018551343_1018551350 -2 Left 1018551343 6:165001865-165001887 CCTGGTACTAAGCCCCTCACTGC 0: 11
1: 569
2: 664
3: 424
4: 308
Right 1018551350 6:165001886-165001908 GCCCGGGGCCACTGCCCACCCGG No data
1018551343_1018551359 24 Left 1018551343 6:165001865-165001887 CCTGGTACTAAGCCCCTCACTGC 0: 11
1: 569
2: 664
3: 424
4: 308
Right 1018551359 6:165001912-165001934 TCGTGCTGGCCCGCGAGCGCTGG No data
1018551343_1018551361 26 Left 1018551343 6:165001865-165001887 CCTGGTACTAAGCCCCTCACTGC 0: 11
1: 569
2: 664
3: 424
4: 308
Right 1018551361 6:165001914-165001936 GTGCTGGCCCGCGAGCGCTGGGG No data
1018551343_1018551354 10 Left 1018551343 6:165001865-165001887 CCTGGTACTAAGCCCCTCACTGC 0: 11
1: 569
2: 664
3: 424
4: 308
Right 1018551354 6:165001898-165001920 TGCCCACCCGGAACTCGTGCTGG No data
1018551343_1018551362 27 Left 1018551343 6:165001865-165001887 CCTGGTACTAAGCCCCTCACTGC 0: 11
1: 569
2: 664
3: 424
4: 308
Right 1018551362 6:165001915-165001937 TGCTGGCCCGCGAGCGCTGGGGG No data
1018551343_1018551360 25 Left 1018551343 6:165001865-165001887 CCTGGTACTAAGCCCCTCACTGC 0: 11
1: 569
2: 664
3: 424
4: 308
Right 1018551360 6:165001913-165001935 CGTGCTGGCCCGCGAGCGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018551343 Original CRISPR GCAGTGAGGGGCTTAGTACC AGG (reversed) Intergenic
900113274 1:1018551-1018573 GCAATGAGGGGCTTAGCACCCGG - Intergenic
900134090 1:1106894-1106916 GCAGTGAGGGGTTTAGCACCTGG + Intronic
900345506 1:2208522-2208544 GCTGGGAGGGGGTGAGTACCAGG + Intronic
900463670 1:2813391-2813413 GCAGTGAGGGGCTTAGCACCTGG + Intergenic
901024400 1:6271509-6271531 GCAATGATGAGCTTAGCACCAGG + Intronic
901045975 1:6395970-6395992 GCAGTGAGGGGCTTAGCACCTGG - Intergenic
901783343 1:11608878-11608900 GCAATGAGGGGCTTAGCACCCGG + Intergenic
902032617 1:13434082-13434104 GCAGTGAGGGGCTTAGCACCTGG - Intergenic
902033442 1:13439399-13439421 GCAGTGAGGGGCTTAGCACCTGG + Intergenic
902100432 1:13983402-13983424 GCAATGAGGGACTTAGCACCCGG - Intergenic
902148152 1:14420742-14420764 GCAGTGAGGGGCTTAGCACCTGG - Intergenic
902404370 1:16174868-16174890 GCAGTGAGGGGCTGAGAGCTGGG - Intergenic
902963959 1:19984691-19984713 GCAGTGAGGGGCTTAGCACCTGG - Intergenic
903227387 1:21901634-21901656 GCAGTCGGGGGCTCAGTCCCAGG - Intronic
903595371 1:24490080-24490102 GCAATGAGGGACTTGGCACCCGG + Intergenic
903624610 1:24721645-24721667 GCAATGAGGGGCTTAGCACCTGG + Intergenic
904238886 1:29131342-29131364 GCAGTGAGGGGCTTAGCACCTGG - Intergenic
905012602 1:34757576-34757598 GCAGTGAGGGGCATGTCACCAGG - Exonic
905375630 1:37518372-37518394 GCAATGGGGGACTTAGCACCCGG + Intergenic
905742890 1:40387973-40387995 GCAATGAGGGGCTTAGCACCTGG + Intronic
906055989 1:42917229-42917251 GCAGTGAGGGGCTTAGCACCCGG - Intergenic
906083217 1:43107751-43107773 GCAGTGAGGGGCTTAGCACCTGG - Intergenic
906563514 1:46778758-46778780 GCAATGAGGGGCTTAGTACCCGG - Intronic
906876139 1:49541454-49541476 GCAGTGAGGGGCTTAGCACCCGG + Intronic
906877712 1:49556941-49556963 GCAGTGAGGGGCTTAGCACCTGG - Intronic
907371148 1:54004466-54004488 GCAGTGAGGGGCTTAGCACTTGG - Intergenic
907980061 1:59472249-59472271 GCAGTGAGGGGCTTAGCACCTGG + Intronic
908027753 1:59969904-59969926 GCAGTGAGGGGCTTAGCACCCGG - Intergenic
908291335 1:62670010-62670032 GCAATGGGGGACTTAGCACCCGG + Intronic
908299922 1:62753552-62753574 GCAGTGAAGGGCTTAGCACCCGG + Intergenic
908301097 1:62761634-62761656 GCAGTGAGGGGCTTAGCACCTGG + Intergenic
908888587 1:68817832-68817854 GCAATGAGGGGCTTAGCACCAGG + Intergenic
909318042 1:74248147-74248169 GCAGTGAGAGGCTTAGCACCTGG - Intronic
909318547 1:74253581-74253603 GCAGTGAGGGGATTAGCACCCGG - Intronic
909608732 1:77531957-77531979 GCAGTGAGGGGCTTAGCACCTGG - Intronic
909820495 1:80053708-80053730 GCAGTGAGGGGCTTAGCACCCGG - Intergenic
909904569 1:81178847-81178869 GCAATGAGGGACTTAGCACCCGG - Intergenic
910034768 1:82777021-82777043 GCAATGAGAGACTTAGCACCCGG - Intergenic
910371787 1:86524049-86524071 GCAGTGAGGGGCTTAGCACCTGG - Intergenic
910550291 1:88467187-88467209 GCAGTGAGGGGCTTAGCACCGGG + Intergenic
910609756 1:89128281-89128303 GCAATGAGGGACTTAGCACCCGG - Intronic
910622662 1:89273582-89273604 GCAGTGAGGGGCTTAGCACCTGG - Intergenic
910625573 1:89303059-89303081 GCAGTGAGTGGCTTAGCACCCGG - Intergenic
910693133 1:89984858-89984880 GCAGTGAGGGGCTTAGCACCTGG - Intergenic
911001453 1:93170387-93170409 GCAGTGAGAAGCTTAGCACCTGG + Intronic
911205921 1:95091487-95091509 GCAATGAAGGGCTTAGCACCTGG + Intergenic
911259602 1:95669868-95669890 GCAATGAGGGGCTTAGCACCCGG - Intergenic
911305237 1:96224578-96224600 GCAATGAGGGACTTAGCACCCGG - Intergenic
911839252 1:102660252-102660274 GCAATGAGGGGCTTAGCACCCGG - Intergenic
911853940 1:102853896-102853918 GCAGTGACCAGCTTAGCACCTGG + Intergenic
911950869 1:104172448-104172470 GCAGTGAGTGGCTTAGCACCTGG + Intergenic
911954496 1:104217684-104217706 GCAATGTGGGACTTAGCACCTGG - Intergenic
912058126 1:105631475-105631497 GCAATGAGGGACTTAGCACCCGG - Intergenic
912166156 1:107044889-107044911 GCACTGAGAGGCTTAGCACCCGG + Intergenic
912312880 1:108641109-108641131 GCAATGGGGGACTTAGCACCCGG - Intronic
912315928 1:108667596-108667618 GCAATGAGGGGCTTAGCACCCGG + Intergenic
912819376 1:112854753-112854775 GCAATGACGGGCTTAGCACCCGG - Intergenic
913161069 1:116146795-116146817 GCAGTGAGAGGCTTAGCACCCGG - Intergenic
913486113 1:119333872-119333894 GCAGTGAGGGGCTTAGCTCCTGG + Intergenic
913692113 1:121289344-121289366 GCAATGGGGGACTTAGCACCCGG - Intronic
914145443 1:144990770-144990792 GCAATGGGGGACTTAGCACCCGG + Intronic
914203439 1:145506110-145506132 GCAATGAGGGGCTTAGCACCCGG - Intergenic
914438444 1:147681006-147681028 GCAATGACTGGCTTAGCACCCGG - Intergenic
914482561 1:148079264-148079286 GCAATGAGGGGCTTAGCACCCGG - Intergenic
914928059 1:151906257-151906279 GCAATGAGGGGCTTAGCACCCGG + Intronic
915104127 1:153521907-153521929 GCAATGAGGGACTTAGCACCAGG + Intergenic
915260052 1:154670871-154670893 GCAATGAGGGGCTTAGCACCTGG + Intergenic
915261222 1:154678158-154678180 GCAATGAGGGGCTTAGCACCCGG + Intergenic
915666113 1:157446522-157446544 GCAATGAGGAGCTTAGCACCCGG - Intergenic
915764494 1:158349229-158349251 GCAATGAGAGACTTAGCACCCGG - Intergenic
915767163 1:158374394-158374416 GCAATGAGGGGCTTAGCACCCGG - Intergenic
915865556 1:159494848-159494870 GCAATGAGGGGCTCAGCACCCGG - Intergenic
915954943 1:160213593-160213615 ACAGTAAGGGGGTTAGGACCAGG - Exonic
916115034 1:161479124-161479146 GCACTGAGGGGCTTAGCACCTGG + Intergenic
916219863 1:162433273-162433295 GCAATGAGGGACTTAGCACCCGG + Intergenic
916910114 1:169337317-169337339 GCAATGAGGGACTTAGCACCCGG - Intronic
916939037 1:169661337-169661359 GCAGTGAGGGGCTTAGCACCTGG + Intergenic
916940074 1:169668175-169668197 GCAGTGAGGGGCTTAGCACCTGG + Intronic
916960280 1:169882231-169882253 GCAATGAGGTGCTTAGCACCTGG + Intronic
917093993 1:171381924-171381946 GCAGTGAGGGGTTTAGCACCTGG - Intergenic
917348863 1:174056612-174056634 GCAGTGAGGGGCTTAGCACCGGG - Intergenic
917406333 1:174711518-174711540 GCAGTGAGGTGCTTCGCACCCGG + Intronic
917445409 1:175102540-175102562 GCAGTGAGGGGCTTAGCACCCGG - Intronic
917446364 1:175108697-175108719 GCAGTGAGGGGCTTAGCACCCGG - Intronic
917473943 1:175352150-175352172 GCAGTGAGGGGCACAGAAGCTGG + Intronic
917578549 1:176349510-176349532 GCAGTGAGGGGCTTAGCACCCGG - Intergenic
917860514 1:179138967-179138989 GCAATGAGGGACTTAGCACCTGG + Intronic
917933000 1:179837170-179837192 GCAATGAGGGGCTTAGCACCCGG - Intergenic
918002236 1:180508722-180508744 GCAGTGAGCGGCTTAGCACCTGG + Intergenic
918059003 1:181045950-181045972 GCAATGAGGGGCTTAGCACCCGG + Intronic
918154574 1:181832536-181832558 GCAGTGAGGGGCTTAGCACCCGG + Intergenic
918512007 1:185321913-185321935 GCAGTGAGGGGCTTAGCACCTGG - Intergenic
918542704 1:185649167-185649189 GCAGTGAGGGGATTAGCTCCCGG - Intergenic
918659763 1:187074056-187074078 GCAGTGAGGGACTTAGCACCCGG - Intergenic
918708940 1:187703740-187703762 GCAATGAGGGGCTTAGCACTCGG + Intergenic
918720833 1:187850322-187850344 GCAATGAGGGGCTTAGTACACGG + Intergenic
918789969 1:188813201-188813223 GCAGTGAGGGGCTTAGCACCCGG + Intergenic
918792040 1:188841414-188841436 GCAATGAGGGGCTTAGCACCCGG - Intergenic
918793176 1:188857780-188857802 GCAGTGCGGGGCTTAGCACCCGG + Intergenic
918853214 1:189718538-189718560 GCAGTGAGGGGCTTAGCACCCGG - Intergenic
918942983 1:191026234-191026256 GCAGTGAGGAGCTTAGCACCCGG - Intergenic
918952005 1:191151546-191151568 GCAGTGAGGGGCTTAGCACCTGG + Intergenic
918993894 1:191731934-191731956 GCCGTGAGGGGCTTAGCACCTGG + Intergenic
919049783 1:192499293-192499315 GCAGTGAGGGGCTTAGCACCTGG - Intergenic
919091900 1:192987031-192987053 GCAATGAGGGACTTAGCACCCGG + Intergenic
919201354 1:194358509-194358531 GCAATGAGGGGCTTAGCACCCGG - Intergenic
919237039 1:194859194-194859216 GCAATGAGGGGCTTAGCACCCGG + Intergenic
919250842 1:195054438-195054460 GCAGTGAGGGGCTTAGCACCTGG + Intergenic
919297764 1:195723110-195723132 GCAGTGAGGCACTTAGCACCTGG - Intergenic
919386870 1:196933832-196933854 GCAGTGAGGGGCTTAGCACCCGG + Intronic
919419774 1:197355635-197355657 GCATTGAGGGGCTTAGCACCCGG - Intronic
919630951 1:199959781-199959803 GCAGTGAGGGGCTTAACACCTGG + Intergenic
920150224 1:203900356-203900378 GCACTGAGGAGCTTAGCACCCGG + Intergenic
920479436 1:206307692-206307714 GCAATGGGGGACTTAGCACCCGG - Intronic
920604869 1:207371637-207371659 GCAGTGAGGGGCTTAGCACCCGG - Intergenic
920731372 1:208488678-208488700 GCAATGAGGGACTTAGCACCTGG - Intergenic
920756675 1:208739798-208739820 GCAATGAGGGGCTTAGCACCCGG + Intergenic
920882036 1:209889186-209889208 ACAGTGAGGGGCTTAGCACCCGG - Intergenic
921801805 1:219410772-219410794 GCAATGGGGGACTTAGCACCCGG + Intergenic
921897095 1:220412552-220412574 GCAATGAGGGACTTAGCACCTGG + Intergenic
921903840 1:220475909-220475931 GCAGTGAGGGGCTTAGCACCCGG - Intergenic
921983675 1:221285898-221285920 GCAATGAGGGGCTTAGCACCGGG - Intergenic
922166149 1:223117197-223117219 GCAGTGAGGGGCTTAGCACCCGG - Intronic
922306969 1:224352715-224352737 GCAGTGAGAGGCTTAGCACCTGG - Intergenic
922485423 1:225969886-225969908 GCAATGAGGGGCTTAGCACCCGG + Intergenic
922541915 1:226426532-226426554 GCAATGAGGGACTTAGCACCCGG - Intergenic
922546849 1:226464318-226464340 GCAGTGAGAGGCTTATCACCTGG + Intergenic
922855791 1:228773825-228773847 GCAATGAGGGACTTAGCACCCGG + Intergenic
922889502 1:229049402-229049424 GCAGCGAGGGGCTCAGAACAGGG - Intergenic
922985876 1:229865576-229865598 GCTGTGAGGGGCTTAGCACCCGG + Intergenic
923000646 1:230004036-230004058 GAAGTGAGGGGCGCAGTGCCTGG - Intergenic
923157235 1:231289715-231289737 GCAATGAGGGACTTAGCACCTGG - Intergenic
923172596 1:231431014-231431036 GCAGTGAGGGGCTTAGCACCTGG - Intergenic
923193447 1:231642145-231642167 GCAGTGAAGGGCTTAGCACCTGG - Intronic
923353175 1:233129227-233129249 GCAGTGAGGGGCTTAGCACCCGG + Intronic
923573814 1:235140414-235140436 GCAGTGAGGGGCTTAGCACCCGG + Intronic
923623227 1:235594627-235594649 GCAGTGAGGGGCTTAGCACCTGG - Intronic
924034800 1:239925009-239925031 ACAGTGAGGGGCTTAGCACCCGG - Intergenic
924313785 1:242774608-242774630 GCAGTGAGGGGCTTAGCACCTGG - Intergenic
1063300395 10:4845155-4845177 GCAATGAGGGGCTTAGCACTCGG - Intronic
1063309303 10:4937623-4937645 GCAGTGAGGGTCTTAGCACCTGG - Intronic
1063318733 10:5032758-5032780 GCAATGAGGGGCTTAGCACCCGG - Intronic
1063321046 10:5053341-5053363 GCAGTGAGGGGCTTAGCACCTGG - Intronic
1063322179 10:5060882-5060904 GCAGTGAGGGACTTAGCACCTGG - Intronic
1064197789 10:13259726-13259748 GCAATGGGGGACTTAGTACCCGG + Intergenic
1064449207 10:15426307-15426329 GCAGTGAGGGTCTTAGCACCTGG - Intergenic
1064461014 10:15535056-15535078 GCTATGAGGGGCTTAGCACCCGG + Intronic
1064790361 10:18951518-18951540 GCAATAAGGGACTTAGCACCAGG - Intergenic
1065284795 10:24176964-24176986 GCAGTGAGGGACTTAGCACCCGG - Intronic
1065554902 10:26905666-26905688 GCAGTGAGGGGCTTAGCACCTGG + Intergenic
1065743282 10:28815913-28815935 GCAGTGAGGGACTTGGCACCCGG - Intergenic
1065752166 10:28897017-28897039 GCAGTGAGGGGCTTAGCACCTGG - Intergenic
1065802600 10:29366299-29366321 GAAATGAGGGACTTAGCACCTGG + Intergenic
1065895893 10:30162975-30162997 GCAGTGAGGGGCTTAGCACCTGG + Intergenic
1065965846 10:30769659-30769681 GCAGTGAGGGGCTTAGCACCTGG - Intergenic
1065981567 10:30903035-30903057 GCAGTGAGGGGATTAGGACCTGG - Intronic
1065983868 10:30930314-30930336 GCAGTGAGGGGCTTAGCACCTGG - Intronic
1065995503 10:31055943-31055965 GTAGTAAGGGGCTTAGCACCTGG + Intergenic
1066186302 10:33013412-33013434 GCAGTGGGGGACTTAGCACCCGG + Intergenic
1066190259 10:33049346-33049368 GCAATGGGGGACTTAGCACCCGG + Intergenic
1066234042 10:33468154-33468176 GCAACGAGGGACTTAGCACCCGG + Intergenic
1066235468 10:33480708-33480730 GCAATGAGGGGCTTAGCACCCGG - Intergenic
1066293622 10:34035515-34035537 GCAGTGATGGGCTTAGCACCTGG + Intergenic
1066296104 10:34055675-34055697 GCAGTGAAGGGCTTAGCACCTGG + Intergenic
1066544246 10:36482238-36482260 GCAATGAGGGGCTTAGCACCAGG - Intergenic
1066568689 10:36748433-36748455 GCAGTGAGGGGCTTAGCACTTGG + Intergenic
1066590567 10:36989532-36989554 GCAGTGAGGGGCTTAGCACCTGG - Intergenic
1066598213 10:37076128-37076150 GCAGTGAGGGGCTTAGCACCTGG + Intergenic
1066613609 10:37275564-37275586 GCAGTGAGGGGCTTACCACCTGG - Intronic
1066660897 10:37737495-37737517 GGCGTGAGGGGCTTAGCACCTGG + Intergenic
1068216669 10:53990932-53990954 GCAGTGAGGGGTTTAGCACCCGG + Intronic
1068374021 10:56155243-56155265 CCAATGAGGGGCTTAGCAGCCGG + Intergenic
1068455535 10:57249959-57249981 GCAGTGAAGGGCTTAGCACCCGG + Intergenic
1068460374 10:57321641-57321663 GCACTGAGGGGCTTAGCACCTGG + Intergenic
1068554962 10:58448496-58448518 GCAGTGAGGGGCTTAGCACCCGG - Intergenic
1068792281 10:61040775-61040797 GCAATGAGGGGCTTAGCACCTGG + Intergenic
1068820970 10:61377111-61377133 GCAGTGAGGGGCTTAGCACCAGG - Intergenic
1068863168 10:61867765-61867787 GCAATGAGGGACTTAGCACCCGG + Intergenic
1068902112 10:62280498-62280520 GCAAAGAGGGACTTAGCACCCGG + Intergenic
1068978137 10:63033709-63033731 GCAATGAGGGGCTTAGCACCCGG + Intergenic
1069090815 10:64197014-64197036 GCAGTGAGGGGCTCAGCACCCGG - Intergenic
1069215345 10:65812292-65812314 GCAGTGAGGGGCTTAGCACCTGG - Intergenic
1069280845 10:66651703-66651725 GCAGTGAGGGGCTTAGCACCCGG - Intronic
1069877242 10:71570617-71570639 GCAGGGAAGGGCTTAGTAAAAGG - Intronic
1069988671 10:72300712-72300734 GCAATGGGGGGCTTAGCACCCGG + Intergenic
1069992970 10:72326074-72326096 GGAATGAGGGGCTTAGCACCCGG + Intergenic
1070172721 10:73944723-73944745 GCAGTGAGGGGCTTAGCACCCGG + Intergenic
1070942562 10:80359729-80359751 GCAGTGAGGAGCTTAGCACTGGG - Intronic
1070968321 10:80543376-80543398 GCAGTGAGGGGCTTAGCACCTGG + Intronic
1070999146 10:80814308-80814330 GCAGTGAGGGGCTTAGCACCTGG + Intergenic
1071003756 10:80859360-80859382 GCAATGGGGGACTTAGCACCCGG + Intergenic
1071055298 10:81502977-81502999 GCAGTGAGGGGCTTAGCACCTGG + Intergenic
1071055699 10:81505946-81505968 GCAGTGAGGGGCTTAGCACCTGG + Intergenic
1071078718 10:81784338-81784360 GCAGTGAGGGGCTTAGCACCCGG + Intergenic
1071085359 10:81862929-81862951 GCAATGAGGGGCTTAGCACCTGG - Intergenic
1071388003 10:85141520-85141542 GCAGTGAGGGGCTTAGCACCCGG + Intergenic
1071797063 10:89018814-89018836 GCAGTGAGGGGCTTAGCACCTGG - Intergenic
1071900990 10:90120024-90120046 GCAGTGAGGGGCTTAGCATCTGG - Intergenic
1071963783 10:90832417-90832439 GCAGTGAGGGGCTTAGCACCTGG - Intronic
1072278496 10:93845312-93845334 GCAGTGAGGGGCTTAGCACCTGG + Intergenic
1072629372 10:97134874-97134896 ACAGTGAGTGGGTTAGTAGCTGG - Intronic
1073262492 10:102201108-102201130 GCAGTGAGGGGCTTAGCACCTGG - Intergenic
1073789775 10:106928343-106928365 GCAATGAGGGGCTTAGCACCCGG - Intronic
1073878312 10:107950698-107950720 GCAGTGAGGGGCTTAGCAACTGG + Intergenic
1074098132 10:110331578-110331600 GCAGTGAGGGGCTTAGCACCCGG + Intergenic
1074314587 10:112349853-112349875 GCAGTGAGGGGCTCAGCACCTGG + Intergenic
1074317008 10:112369908-112369930 GCAGTGAGAGGCTTAGCACCTGG + Intergenic
1074732475 10:116393527-116393549 GCAGTGAGGGGCTTAGCACCTGG + Intergenic
1074996345 10:118760387-118760409 GCAGTGAGGGGCTTAGCACCTGG - Intergenic
1074999231 10:118783023-118783045 GCAATGGGGGACTTAGCACCCGG + Intergenic
1075216914 10:120544434-120544456 GCAGTGAGGAGCTTAGCAGCAGG - Intronic
1075255620 10:120923945-120923967 GCAATGAGGGGCTTAGCACCCGG + Intergenic
1075269381 10:121035579-121035601 GCAATGAGGGACTTAGCACCCGG - Intergenic
1075305720 10:121365695-121365717 GCAGTGATGGGCTTAGCACCTGG + Intergenic
1075307633 10:121382282-121382304 GCAGTGAGGGGCTTAGCACCTGG + Intergenic
1075376027 10:121978629-121978651 GCAGTGAGGGGCTTAGCACCTGG - Intergenic
1075537531 10:123283593-123283615 GCAAGGAGGGGCTTAGTACCCGG - Intergenic
1076261659 10:129071592-129071614 GCAATGAGGGGCTTAGCACCTGG - Intergenic
1076295229 10:129378655-129378677 CCAGAGAGAGACTTAGTACCTGG - Intergenic
1076773608 10:132680773-132680795 GCAATGAGGGGCTTAGCACCCGG + Intronic
1076796539 10:132801185-132801207 GCAATGAGGGGCTTAGCACCCGG - Intergenic
1077583789 11:3435184-3435206 GCAGTGAGGGGCTTAGCACCTGG - Intergenic
1077603243 11:3588846-3588868 GCAGTGAGGGGTTTAACACCTGG + Intergenic
1077764592 11:5144535-5144557 GCAGTGAGGGGCTTAGCACCTGG + Intergenic
1077764598 11:5144558-5144580 GCAGTGAGGGGCTTAGCACCTGG + Intergenic
1077778206 11:5294638-5294660 GCAGTGAGGGGCTTAGCACCTGG - Intronic
1077805762 11:5589999-5590021 GCAACGAGGGGCTTAGCACCCGG + Intronic
1077815616 11:5683067-5683089 GCAGTGAGCGGCTTAGCACCTGG + Intronic
1078743697 11:14091567-14091589 GCAATGAGGGACTTAGCACCCGG - Intronic
1078891327 11:15561032-15561054 GCAGTGAGGGGCTTAGCACCCGG + Intergenic
1079190976 11:18276333-18276355 GCAGTGAGGGGCTTAGCACCTGG - Intergenic
1079555414 11:21753338-21753360 GCAGTGAGGGGTTTAACGCCTGG - Intergenic
1079726222 11:23883671-23883693 GCAATGAGGGACTTAGCACCTGG - Intergenic
1079730573 11:23934989-23935011 GCAATGAGGGGCTTAGCACCCGG - Intergenic
1079756807 11:24274481-24274503 GCAGTGAGGGGCTTAGCACCTGG - Intergenic
1079767779 11:24416240-24416262 GCAATGAGGGGCTTAGCACCCGG - Intergenic
1079803168 11:24896412-24896434 GCAGTGAGGGGCTTAGCACCTGG + Intronic
1080106025 11:28512571-28512593 GCAATGAGGGGCTTAGCACCCGG - Intergenic
1080107504 11:28526040-28526062 GCAGTGAGGTGCTTAGCACCCGG - Intergenic
1080195198 11:29600386-29600408 GCAATGAGGGACTTAGCACCCGG - Intergenic
1080223515 11:29934283-29934305 GCAGTGAGGGGCTTAGCACCCGG + Intergenic
1080503078 11:32888408-32888430 GCAGTGAGGGGCTTAGCACCTGG - Intergenic
1080557695 11:33431983-33432005 GCAATGAGGGACTTAGCACCCGG - Intergenic
1081046411 11:38278839-38278861 GCAGTGAGGGGCTTAGCACCCGG - Intergenic
1081115333 11:39192791-39192813 GCGATGAGAGGCTTAGCACCTGG - Intergenic
1081126942 11:39333309-39333331 GCAATGAGGAGCTTAGCACCCGG - Intergenic
1081136153 11:39442302-39442324 GCAGTGAGGGGCTTAGCACCCGG - Intergenic
1081315204 11:41622995-41623017 GCAGTGAGGGGCTTAGCATCTGG + Intergenic
1081374711 11:42344573-42344595 GCAGTGAGGGGCTTAGCACCCGG - Intergenic
1081420894 11:42874038-42874060 GTAGTGAGGGGCTTAGCACCCGG + Intergenic
1081422065 11:42881503-42881525 GTAATGAGGGGCTTAGCACCCGG + Intergenic
1081428384 11:42950006-42950028 GCAATGAGGGACTTAGCACCCGG + Intergenic
1082270428 11:50164241-50164263 GCAGTGAGTGGCTTAGCACCTGG - Intergenic
1082734919 11:56845317-56845339 GCAGTGAGGGGCTTAGCACCTGG + Intergenic
1082759785 11:57116289-57116311 ACAGTCAGGGGCTCAGCACCAGG + Intergenic
1082912329 11:58390811-58390833 GCAATGAGGGGCTTAGCACCCGG - Intergenic
1083074291 11:60020455-60020477 GCAGTGAGGGGCTTAGCACCTGG - Intergenic
1083546108 11:63550326-63550348 GCAATGAGGGACTTAGCACCCGG + Intergenic
1084024742 11:66440973-66440995 GCAGTAAGGGGCTTAGCACCTGG - Intronic
1084107407 11:66988915-66988937 GCAATGAGGGACTTAGCACCCGG + Intergenic
1084186653 11:67476212-67476234 GCAGTGAGGGGCTTAGCACCTGG + Intergenic
1084210459 11:67619157-67619179 GCAATGAGGGGCTTAGCACCCGG + Intergenic
1084240691 11:67817856-67817878 GCAGTGAGGGGCTTAGCACCTGG - Intergenic
1084259139 11:67963389-67963411 GCAGTGAGGAGCTTAGCAACTGG + Intergenic
1084574060 11:69977403-69977425 GCAGCGAGGGCCTGAGCACCTGG + Intergenic
1084813632 11:71631790-71631812 GCAGTGAAGGGCTTAACACCTGG - Intergenic
1084831739 11:71774856-71774878 GTAGTGAGGGGCTTAGCACCTGG + Intergenic
1085245595 11:75098327-75098349 GCAATAAGAGGCTTAGCACCCGG + Intergenic
1085367765 11:75967309-75967331 GCAGTAACAGGCTTAGAACCCGG - Intronic
1085375883 11:76060685-76060707 GCAGTGAGGGGCTTAGCACCCGG + Intronic
1085447248 11:76609269-76609291 GCAATGAGGGACTTAGCACCCGG - Intergenic
1085671084 11:78465167-78465189 GCAGTGAGGGGCTTAGCACCTGG - Intronic
1085687688 11:78638971-78638993 GCAGTGAGGGGCTTAGCACCTGG + Intergenic
1085863127 11:80257683-80257705 GCAGTGAGGGGCTTAGCACCCGG + Intergenic
1085982806 11:81744766-81744788 GCACTGAGGAGCTTAGCACCCGG - Intergenic
1086001610 11:81991118-81991140 GTAGTGAGGGGCTTAGCACCTGG - Intergenic
1086043032 11:82501279-82501301 GCAGTGAGGGCCTTAGCACCTGG + Intergenic
1086087562 11:82970793-82970815 GCAGTAAGGGGTTTAGCACCCGG + Intergenic
1086210126 11:84308776-84308798 GCAATGACGGGCTTAGCACCCGG - Intronic
1086397751 11:86433761-86433783 GCAATGAGGGGCTTAGCACCCGG - Intergenic
1086552493 11:88069171-88069193 GAAGTGAGGGGCTTAGCACCCGG + Intergenic
1086724648 11:90167308-90167330 GCAGTAAGGGGCTTAGCGCCTGG + Intronic
1086808015 11:91268877-91268899 GCAATGAGGGGCTTAGCACCCGG + Intergenic
1087354538 11:97076721-97076743 GCAATGAGGGGCTTAGCACCCGG + Intergenic
1087401008 11:97667204-97667226 GCAGTGAGGGGCTTAGCACCCGG + Intergenic
1087486393 11:98763650-98763672 GCAATGAGGGGCTTAGCACCTGG - Intergenic
1087682349 11:101231575-101231597 GCAGTGAGGGGCCTAGCACCTGG - Intergenic
1087683807 11:101241489-101241511 GCAGTGAGGGGCTTAGCACTTGG - Intergenic
1087977268 11:104565188-104565210 GCAGTGAGGGGCTTAGCACCCGG - Intergenic
1088481704 11:110301135-110301157 GCAGTGATGGTCTTAGCACCTGG - Intergenic
1088570875 11:111222099-111222121 GCAATGAGGGACTTAGCACCCGG + Intergenic
1088843971 11:113649584-113649606 GCAGTGAGGGGCTTAGCAGCCGG - Intergenic
1089062124 11:115634133-115634155 GCAATGAGGAGCTTAGGACCCGG - Intergenic
1089244738 11:117110692-117110714 GCAGTGAGGGGCTTAGCACTCGG - Intergenic
1089373576 11:117978727-117978749 GCAATGAGGGACTTAGCACCCGG - Intergenic
1089466408 11:118689214-118689236 GCAATGAAGGACTTAGCACCCGG - Intergenic
1089650911 11:119912223-119912245 GCAGTGAGAGGATTATTATCAGG - Intergenic
1089800236 11:121021780-121021802 GCAATGAGGGGCTTAGCACCCGG + Intergenic
1090133549 11:124170918-124170940 GCAGTGAGGGGCTTAGCACCTGG - Intergenic
1090229221 11:125089617-125089639 GCAGTGAGGGACTTGGCACCCGG + Intronic
1090307687 11:125704942-125704964 GCAATGAGGGACTTAACACCCGG - Intergenic
1090586192 11:128215512-128215534 GCAATGAGGGGCTTAGCACCCGG - Intergenic
1090588261 11:128237210-128237232 GCAGTGACGGGCTTAGCACCTGG + Intergenic
1090776726 11:129972061-129972083 GCAGTGAGGGGCTTAGCACCCGG - Intronic
1090782726 11:130021793-130021815 GCAGTGAGGGGCTTAGCGCCCGG + Intergenic
1090820520 11:130337600-130337622 GCAGTGAGGGGCTTAGCACCTGG - Intergenic
1091201200 11:133782423-133782445 GCAATGAGGGGCTTAGCACCTGG + Intergenic
1091233454 11:134003102-134003124 GCAATGAGGGACTTAGCACCCGG - Intergenic
1091402241 12:188314-188336 GCAGTGAGGGGCTTAGCACCTGG - Intergenic
1091493032 12:949415-949437 GCAGTGAGGGGCTCAGTATCCGG - Intronic
1092101692 12:5889088-5889110 GCAGTGAGAGGCTTAGCACCTGG - Intronic
1092133960 12:6132730-6132752 GCAGTGAGGGGCTTAGCACCTGG + Intergenic
1092135199 12:6142317-6142339 GCAATGAGGGACTTAGCACCCGG + Intergenic
1092142106 12:6191110-6191132 GCAATGAGGGGCTTAGCACCCGG - Intergenic
1092220285 12:6708403-6708425 GCAATGAGGGACTTAGCACCCGG + Intergenic
1092221398 12:6716157-6716179 GCAATGGGGGACTTAGCACCCGG + Intergenic
1092253457 12:6914283-6914305 GCAGTGTGGGCCTTCGTACCCGG + Intronic
1092336676 12:7639960-7639982 GCAGTGAGGGGCTTAGCACCCGG + Intergenic
1092350521 12:7752313-7752335 GCAATGAGGGGCTTAGCACCCGG - Intergenic
1092366552 12:7881403-7881425 GCAATGAGGGATTTAGCACCTGG + Intronic
1092410929 12:8252430-8252452 GTAGTGAGGGGCTTAGCACCTGG - Intergenic
1092430451 12:8404394-8404416 GCAATGAGGGGCCTCGCACCTGG + Intergenic
1092471769 12:8787387-8787409 GCAATGAGGGGCTTAGCACCTGG + Intergenic
1092472961 12:8794844-8794866 GCAGTGAGGGGCTTAGTACCTGG + Intergenic
1092545855 12:9450629-9450651 GCAGTGAGGGGTTTAGTACCTGG - Intergenic
1092572424 12:9739816-9739838 GCAATGAGGGGCTTAGCACCCGG - Intergenic
1092578922 12:9819035-9819057 GCAGTGAGTGACTGAGCACCTGG + Intergenic
1092583808 12:9876280-9876302 GCAATGAGGGGCTTAGCACCCGG - Intergenic
1092617156 12:10225868-10225890 GCAATGGGGGACTTAGCACCCGG - Intergenic
1092732468 12:11547412-11547434 GCAGTGAAGGGCTTATCACCTGG + Intergenic
1093034493 12:14320214-14320236 GCAATGAGGGGCTTGGCACCCGG + Intergenic
1093172355 12:15874748-15874770 GCAGTGAGGGGCTTAGCACCTGG + Intronic
1093189400 12:16057503-16057525 GCAATGAGGGGCTTAGCACCCGG + Intergenic
1093266270 12:17007744-17007766 GCAATAAGGGGCTTAGCACCTGG + Intergenic
1093346268 12:18040375-18040397 GCAGTGAGGGGCTTAGCACCTGG + Intergenic
1093524784 12:20093523-20093545 GCAGTGAGGGGCTTAGCACCTGG - Intergenic
1093527091 12:20115469-20115491 GCAGTGAGGGGCTTAGCACCCGG - Intergenic
1093580836 12:20782732-20782754 GAATTCAGGGGCTTAATACCGGG - Intergenic
1093583277 12:20807680-20807702 GCAGTGAGGGCCTTAGCACCTGG - Intergenic
1093652548 12:21661650-21661672 GCAATGAGGGGCTTAGCACCCGG + Intronic
1093653944 12:21674292-21674314 GCAGTGAGGGACTTAGCACCCGG - Intronic
1093741379 12:22693284-22693306 GCAGTGAGGAGCTTAGCACCCGG - Intergenic
1093793711 12:23286046-23286068 GCCGGCAGGGGCTTAGCACCCGG + Intergenic
1093970211 12:25369487-25369509 GCAATGAGGGGCTTAGCACCCGG + Intergenic
1094000147 12:25686371-25686393 GCAGTGAGGGGCTTAGCACCTGG + Intergenic
1094108783 12:26839293-26839315 GCAATGAGGGTCTTAGCACCTGG + Intergenic
1094338611 12:29386480-29386502 GCAGTGAGGGGCTTAGCACCCGG - Intergenic
1094405351 12:30110688-30110710 TCAGTGAGGGGCTTAGCACCTGG - Intergenic
1094409833 12:30156991-30157013 GCAGTGAGGGACTTAGCACCCGG + Intergenic
1094448719 12:30561754-30561776 GCAATGGGGGACTTAGGACCCGG + Intergenic
1094507100 12:31071444-31071466 GCAGTGAGGGGTTTAGTACCTGG + Intergenic
1094661280 12:32472412-32472434 GCAATGGGGGACTTAGCACCCGG + Intronic
1094666485 12:32525794-32525816 GCAATGGGGGACTTAGCACCCGG + Intronic
1094722060 12:33075465-33075487 GCAGTGAGGGGCTTAGCACCTGG + Intergenic
1095123092 12:38442069-38442091 GCAATGAGGGGCTTAGCACCTGG + Intergenic
1095304155 12:40620776-40620798 GCAGTGAGGGGCTTAGCACCTGG + Intergenic
1095533978 12:43224443-43224465 GCAGTGAGGGGATTAGCACCTGG + Intergenic
1095587407 12:43864014-43864036 ACAGTGAGGGGCTTAGCACCCGG + Intronic
1095642374 12:44500514-44500536 GCAGTGAGAGGCTTAGCACCTGG + Intergenic
1095776702 12:46018137-46018159 GCAATGAGGGGCTTAGCACCTGG + Intergenic
1095901540 12:47333505-47333527 GCAATGAGGGGCTTAGCACCTGG + Intergenic
1097017927 12:56000383-56000405 GCAATGAGGGGCTTACCACCTGG - Intronic
1097128943 12:56796079-56796101 GCAATGGGGGACTTAGCACCCGG - Intergenic
1097212944 12:57386432-57386454 GCAGTGAGGGGCTTAGCACCTGG + Intronic
1097664188 12:62461473-62461495 CCAGTGAGGGGCTTAGCACCTGG - Intergenic
1097788820 12:63792005-63792027 GCACTGAAAGGCTAAGTACCTGG + Intronic
1097863840 12:64543253-64543275 GCAGTGAGGGGCTTAGCACCCGG + Intergenic
1097982015 12:65744479-65744501 GTAGTGAGGGGCTTAGCACCTGG + Intergenic
1098168221 12:67719472-67719494 GCAATGAGGGGCTTAGCACCCGG - Intergenic
1098498762 12:71166448-71166470 GCAGTGAGGGGCTTTGCACCCGG - Intronic
1098515983 12:71376964-71376986 GCAGTGAGGGGCTTAGCACCTGG + Intronic
1098588667 12:72185166-72185188 GCAATGAGGGACTTAGCACCCGG + Intronic
1098759239 12:74403067-74403089 GCAATGAGGGACTTAGCACCCGG + Intergenic
1099190956 12:79561660-79561682 GCAGTGAGGGGCTTAGCACCCGG + Intergenic
1099191383 12:79565072-79565094 GCAGTGAGGGGCTTAGCACCCGG + Intergenic
1099192439 12:79574030-79574052 GCAGTGACGGGATTACCACCTGG + Intergenic
1099204352 12:79711055-79711077 GCAGTGAGGGGCTTAGCACCCGG + Intergenic
1099228163 12:79993464-79993486 GCAATGAGGGGCTTAGCACCCGG - Intergenic
1099443829 12:82728889-82728911 GCAGTGAGGAGCTTAGCACCTGG + Intronic
1099478667 12:83140240-83140262 GCAATGAGGAGCTTAGCACCCGG + Intergenic
1099523939 12:83696526-83696548 GCAATGAGGGACTTAGCACCTGG - Intergenic
1099559623 12:84155361-84155383 GCAATGAGGGACTTAGCACCCGG - Intergenic
1099716233 12:86296642-86296664 GCAGTGAGGGGCTTAGCACCCGG - Intronic
1099790709 12:87330336-87330358 GCAGTGAGGGACTTAGCACCCGG + Intergenic
1100142330 12:91634039-91634061 GCAATGAGGAGCTTAGCACCCGG + Intergenic
1100166621 12:91924147-91924169 GCAATGAGGGGCTTAGCACCGGG - Intergenic
1100211887 12:92406758-92406780 GCAATGAGGGGCTTAGCACCCGG - Intergenic
1100584695 12:95969255-95969277 GCAGTGAGGGACTTAGCACGCGG + Intergenic
1100600647 12:96109025-96109047 GTACTGAGGGGTTTAGCACCTGG + Intergenic
1100734621 12:97512982-97513004 GCAGTGAGGGGCTTAGCACCTGG - Intergenic
1101008988 12:100430422-100430444 GCAATGAGGGGCTTAGCACCCGG + Intergenic
1101461965 12:104905752-104905774 GCAATGGGGGACTTAGCACCCGG - Intronic
1102258119 12:111427969-111427991 GCTGAGAGGGGCTTGGAACCTGG + Intronic
1102309755 12:111835774-111835796 GCAATGAGGGGCTTAGCACACGG + Intergenic
1102387235 12:112520129-112520151 GCAGTGAGGGGCTTAGCACCTGG - Intergenic
1102904021 12:116660845-116660867 GCAGTGAGGGGCTTAGCACCTGG + Intergenic
1103146148 12:118597415-118597437 GCAGTGAGGGACTTGGCACCCGG - Intergenic
1103239110 12:119398280-119398302 GCAGTGATGCGCTTAGCATCTGG - Intronic
1103439234 12:120950581-120950603 GCAATGAGGGGCTTAGCACCCGG - Intergenic
1103459663 12:121093748-121093770 GCAGTGAGGGGCTTAGCACCTGG - Intergenic
1103497557 12:121374585-121374607 GCAGTGAGGGGCTTAGCACCTGG + Intronic
1103668543 12:122592145-122592167 GCAGTGAGGGGCTTAGCACCCGG + Intronic
1103678711 12:122676836-122676858 GCAGTGAGGGCCTTAGCACCTGG - Intergenic
1103783398 12:123414353-123414375 GCAATGAGGGGCTTAGCACCCGG - Exonic
1104373872 12:128247363-128247385 GCAGTGAGGGGCTTAGCACCCGG + Intergenic
1104582636 12:130022175-130022197 GCAATGAGGGACTTAGCACCCGG + Intergenic
1104614519 12:130256894-130256916 GCAATGAGGGACTTAGCACCCGG - Intergenic
1104749235 12:131227932-131227954 GCAATGAGGGACTTAGCACCCGG + Intergenic
1105037748 12:132938874-132938896 GCAATGGGGGACTTAGCACCCGG + Intronic
1105425643 13:20292537-20292559 GGAATGAGGGGCTTAGCACCCGG + Intergenic
1105605158 13:21920905-21920927 GCAGTGAGGGGCTTAGCACCTGG - Intergenic
1105697223 13:22900649-22900671 GCAGTGAGGGGCTTATCACCTGG - Intergenic
1105723904 13:23142256-23142278 GCAGTAAGGGCCTTAGCACCCGG + Intergenic
1105777638 13:23678052-23678074 GCAGTGAGGGGCTTTGCACCAGG - Intergenic
1105871145 13:24507046-24507068 ACAGTGAGGGGCTTAGCGTCCGG - Intronic
1105876687 13:24560945-24560967 GCAGTGAGGGGCTTAGCACCTGG - Intergenic
1105883478 13:24623477-24623499 GCAGTGATGGGCTTAGCACCCGG + Intergenic
1106221331 13:27748554-27748576 GCAATGAGGGACTTAGCACCCGG - Intergenic
1106600549 13:31183250-31183272 GCAGTGAGGGGCTTAGCACCTGG - Intergenic
1106617068 13:31339906-31339928 GCAATGGGGGACTTAGCACCCGG - Intergenic
1106643435 13:31609067-31609089 GCAATGAGGGACTTAGCACCCGG - Intergenic
1106810945 13:33358101-33358123 GCAATGAGGGACTTAGCACCCGG + Intergenic
1106840636 13:33682221-33682243 GCAGTGAAGGGCTTAGCACCTGG + Intergenic
1107259385 13:38472670-38472692 GCAATGAGGGACTTAGCACCCGG - Intergenic
1107590468 13:41898819-41898841 GCAATGAGGGACTTAGCACCCGG - Intronic
1107652588 13:42559889-42559911 GCAGTGACGGGCTTAGCACCTGG + Intergenic
1107836111 13:44413695-44413717 GCAATGAGGGGCTTAGCACCCGG + Intergenic
1108099182 13:46936295-46936317 GCAATGAGGGACTTAGCACCCGG - Intergenic
1108239619 13:48449370-48449392 GCAGTGAGGTACTGAGTAACAGG - Intronic
1108435338 13:50396715-50396737 GCAATGAGGGGCTTAGCTCCCGG + Intronic
1108469461 13:50753547-50753569 GCAATGAGGGGCTTAGCAACCGG - Intronic
1108643977 13:52408316-52408338 GCAATGAGGGGCTTAGCACCTGG - Intergenic
1108686729 13:52826381-52826403 GCAGTGGAGGGCTTAGCACCCGG + Intergenic
1108751537 13:53452633-53452655 GCAATGAGGGACTTAGCACCCGG - Intergenic
1108845665 13:54676691-54676713 GCAGTGAGGGGCTTAGCACCTGG + Intergenic
1108851618 13:54737516-54737538 GCAATGGGGGACTTAGCACCCGG - Intergenic
1108858963 13:54829740-54829762 GCAATGAGGGGCTTAGCACCCGG - Intergenic
1108991146 13:56659353-56659375 GCAGTGAGGGGCTTAGCACCCGG - Intergenic
1108996010 13:56735727-56735749 GCAGTGAGGGGCTTAGCACCTGG + Intergenic
1109037734 13:57286846-57286868 GCAGTGAGAAGCTTAGCACCTGG - Intergenic
1109124705 13:58504466-58504488 GCAGTGAGGGGCTTAGCACCTGG - Intergenic
1109141044 13:58714203-58714225 GCAATGGGGGACTTAGCACCCGG + Intergenic
1109145406 13:58773438-58773460 GCAGTGAGGGACTTAGCACCTGG + Intergenic
1109152125 13:58859099-58859121 GCAGTGAAGGGCTTAGCACCTGG - Intergenic
1109159876 13:58958422-58958444 GCAATGAGGGGCTTAGCACCTGG - Intergenic
1109416455 13:62046778-62046800 GCAGTGAGGGGCTTAGCACCTGG - Intergenic
1109441365 13:62379348-62379370 GCAATGGGGGACTTAGCACCCGG + Intergenic
1109446615 13:62448139-62448161 GCAATGAGGGGCTTAGCACCCGG - Intergenic
1109506149 13:63305855-63305877 GAAGTGAGGGGCTTAGCACCCGG + Intergenic
1109563157 13:64077734-64077756 GCAGTGAGGGGCTTAGCACCTGG - Intergenic
1109624667 13:64959006-64959028 GCAGTGAAGGGCATAGGAACCGG - Intergenic
1109638094 13:65149813-65149835 GCAGTGAGGGGCTTAGCACCCGG - Intergenic
1109699695 13:66009490-66009512 GCAGTGAGGGGCTTAGCACCCGG + Intergenic
1109741531 13:66561184-66561206 GCAGTGAGGGGCTTAGCGCCTGG + Intronic
1109745816 13:66622069-66622091 GCAATGAGGGGCTTAGCACCCGG + Intronic
1109854301 13:68107957-68107979 GCAGTGAGGGGCTTAGCACCCGG - Intergenic
1109858815 13:68171082-68171104 TCCGTGAGGGGCTTAGCACCTGG + Intergenic
1110368863 13:74718512-74718534 GCAATGAGGGACTTAGCACCCGG + Intergenic
1110440189 13:75518673-75518695 GCAGTGAGGGGTTTAGCACCCGG + Intergenic
1110497851 13:76190220-76190242 GCAGTGAGGGGCTTAGCACCCGG + Intergenic
1110609817 13:77475696-77475718 GCAGTGAGAGGCTTAGCACCTGG - Intergenic
1110751397 13:79119861-79119883 GCAATGAGGGGCTTAGCACCTGG - Intergenic
1110792397 13:79600398-79600420 GCAATGAGGGGCTTAGCACCCGG - Intergenic
1110854211 13:80278891-80278913 GCAGTGAGGGGCTTAGCACTGGG - Intergenic
1110862131 13:80355667-80355689 GCAATGAGGGGCTTAGCACCCGG + Intergenic
1110999850 13:82165190-82165212 GCAATAAGGAGCTTAGCACCTGG - Intergenic
1111138785 13:84086613-84086635 GCAGTGAGGGGCTTAGCACCTGG - Intergenic
1111220903 13:85205033-85205055 GCAGTGAGGGGTTTAGCACCCGG + Intergenic
1111333564 13:86792377-86792399 GCAGTGAGGGGCTTAGCACCTGG + Intergenic
1111556175 13:89884069-89884091 GCAGTGAGGGGCTTAGCACCTGG - Intergenic
1111602718 13:90494900-90494922 GAAATGAGGGGCTTAGCACCCGG + Intergenic
1111682682 13:91463061-91463083 GCAGTGGGGGGATTTGTTCCAGG + Intronic
1111747686 13:92291009-92291031 GTAGTGAGGGGTTTAGCACCTGG + Intronic
1111841417 13:93455025-93455047 GCAATAAGGGGCTTAGCACCCGG - Intronic
1112077761 13:95931681-95931703 GCAGTGAGGGGCGTAGCACCCGG - Intronic
1112282688 13:98076532-98076554 GCAGTGAGGGGCTTAGCACCTGG - Intergenic
1112518642 13:100077636-100077658 GCAATGAGGGGCTTAGCACCCGG + Intergenic
1112538264 13:100282548-100282570 GCAATGAGGGGCTTAGCACCCGG + Intronic
1112705848 13:102068594-102068616 GCAGTGAGCGACTTGGCACCCGG + Intronic
1112842701 13:103600102-103600124 GCAGTGAGGGGCTTAGCACCTGG + Intergenic
1113330186 13:109319297-109319319 GCAGTGAAGGGCTTGGCACCTGG - Intergenic
1113482688 13:110633269-110633291 GCAATGAGGGACTTAGCACCCGG - Intronic
1113506634 13:110821280-110821302 GCAATGAGGGACTTAGCACCTGG + Intergenic
1113538136 13:111084112-111084134 GCAATGGGGGACTTAGCACCCGG - Intergenic
1113678051 13:112221837-112221859 GCAATGAGGGACTTAGCACCCGG + Intergenic
1113680256 13:112238808-112238830 GCAGTGACAGGCTTAGCACCTGG + Intergenic
1113955769 13:114099299-114099321 GCAGGGAGGAGCTTCGTCCCCGG - Intronic
1114155547 14:20099318-20099340 GCAGTGAGGGGCTTCGCACCTGG + Intergenic
1114560311 14:23585122-23585144 GCAATGGGGGACTTAGCACCCGG - Intergenic
1114593530 14:23891877-23891899 GCAATGAGGGACTTAGCACCCGG + Intergenic
1115118278 14:29909117-29909139 GCAGTGAGGGGCTTAGCACCTGG + Intronic
1115174599 14:30547757-30547779 GCAGTGAGGGGCTTAGCACCCGG - Intergenic
1115284249 14:31700666-31700688 GCAGTGAGGGGCTTAGCACCTGG + Intronic
1115421354 14:33198975-33198997 ACAGTGTGGGGCTTAGCATCTGG - Intronic
1115533240 14:34346039-34346061 GCAGTGAGGGGCTTAGCACCTGG - Intronic
1116114505 14:40629880-40629902 GCAATGAGGGGCTTAGCATCCGG - Intergenic
1116152128 14:41154480-41154502 GCAGTGAGGGGCTTAGCACCCGG - Intergenic
1116223182 14:42113689-42113711 GCAGTGAGGGGCTTAGCACCTGG - Intergenic
1116251038 14:42482631-42482653 GCAATGAGGGACTTAGCACCCGG - Intergenic
1116297912 14:43136167-43136189 GCAGTGAGGGGCTTAGCACCCGG - Intergenic
1116311009 14:43326725-43326747 GCAGTGAGGGGCTTAGCACCTGG + Intergenic
1116325800 14:43533150-43533172 GTAGTGAGGGGCTTAGCACCCGG + Intergenic
1116426525 14:44798713-44798735 GCAGTGAGGGGCTTAGCACCTGG + Intergenic
1116437597 14:44912289-44912311 GCAGTAAGGGGCTTAGCACCGGG + Intergenic
1116452358 14:45080557-45080579 GCAATGAGGGGCTTAGCACCTGG + Intergenic
1116594377 14:46820554-46820576 ACAGTGAGGGGCTTAGCACCCGG + Intergenic
1116624012 14:47242564-47242586 GCAATGGGGGACTTAGCACCCGG + Intronic
1116653778 14:47626677-47626699 GCGGTGAGGGGCTTAGCACCTGG + Intronic
1116656958 14:47665651-47665673 GCAATGGGGGGCTTAGCACCTGG + Intronic
1116900962 14:50362046-50362068 GCAGTGAGGGGCTTAGCACCTGG + Intronic
1117082588 14:52166867-52166889 GCAGTGAGGGGCTTAGCACCTGG + Intergenic
1117183654 14:53217751-53217773 GCAGTGAGGGGTTTAGCACCCGG - Intergenic
1117297484 14:54393223-54393245 GCAGTGAGGAGCTTAGCACCTGG - Intergenic
1117302508 14:54443172-54443194 GTGATGAGGGGCTTAGCACCCGG + Intergenic
1117449816 14:55839629-55839651 GCAGTGAGGGGCTTAGCACCTGG + Intergenic
1117565627 14:56991140-56991162 GCAATGAGGGGCTTAGCACCCGG + Intergenic
1117571926 14:57056855-57056877 GCAATGGGGGACTTAGCACCCGG - Intergenic
1117727342 14:58687502-58687524 GCAGTGAGGAGCTTAGCACCTGG - Intergenic
1117742620 14:58834039-58834061 GCAGTGAGGAGCTTAGCACCTGG + Intergenic
1117837255 14:59819809-59819831 GCAGTGAGGGGCTTAGCACCTGG - Intronic
1118215372 14:63803504-63803526 GCAATGAGGGACTTAGCACCCGG - Intergenic
1118306330 14:64658287-64658309 GCAGTGAGGGGCTTAGCACCTGG + Intergenic
1118932362 14:70254835-70254857 GCAGTGAGGAGCTTAGCACCTGG + Intergenic
1119027782 14:71167658-71167680 GCAGTGAGGGGCTTAGCACCTGG + Intergenic
1119038839 14:71254417-71254439 GCAATGAGGGGCTTAGCACCTGG + Intergenic
1119300322 14:73566573-73566595 GCAATGAGGGGCTTAGCACCTGG - Intergenic
1119303673 14:73590675-73590697 GCAGTGAGGGGCTTAGCACCTGG - Intergenic
1119486775 14:74994269-74994291 GCAATGGGGGACTTAGCACCCGG + Intergenic
1119673453 14:76536990-76537012 GCAATGAGGGACTTAGCATCTGG - Intergenic
1119695050 14:76706904-76706926 GCAGTGAGGGGCTTAGCACCAGG - Intergenic
1120169680 14:81236213-81236235 GCAGTGAGGGGCTTAGCACCTGG + Intergenic
1120214679 14:81668951-81668973 GCAGTGAGGGGCTTAGCACCCGG - Intergenic
1120229768 14:81829696-81829718 GCAGTGAGGGGCTTACCACCCGG - Intergenic
1120330979 14:83092505-83092527 GCAATGAGGGATTTAGCACCCGG + Intergenic
1120429753 14:84399604-84399626 GCAATGAGGGGCTTAGCATCCGG - Intergenic
1120844161 14:89111768-89111790 GCAATGAGGGACTTAGCACCCGG + Intergenic
1121145370 14:91578077-91578099 ACAGTGAGAGGCTTAGCACCCGG + Intergenic
1121283494 14:92716151-92716173 GCAGTGAAGGGCATAGGATCCGG - Exonic
1122216538 14:100208408-100208430 GCAGTGAGGGGCTTAGCACCTGG - Intergenic
1122434977 14:101689200-101689222 GCAGTGAGGGGCTTAGCACCTGG + Intergenic
1122493462 14:102135750-102135772 GCAATGAGGGACTTAGCACCCGG - Intronic
1122514531 14:102297806-102297828 GCAGTGACGGGTTTAGCACCCGG + Intronic
1122611937 14:102990601-102990623 GCACTGAGGGGCCTAGAAGCAGG + Intronic
1122894826 14:104751738-104751760 GCAGTGAGGAGCTTAGCACCCGG - Intergenic
1122976775 14:105174094-105174116 GCAGCGAGGTCCTCAGTACCAGG + Intronic
1123051879 14:105547947-105547969 GCAGTGAGGGGCTTAGCACCCGG + Intergenic
1123825578 15:24078666-24078688 GCAGTGAGGTGCTTAGCATCTGG - Intergenic
1123949133 15:25253433-25253455 GCAATGAGGGGCTTAGCACCCGG - Intergenic
1124036368 15:26057036-26057058 GCAGTGAGGGGCTTAGCACCTGG + Intergenic
1124061591 15:26298302-26298324 GCAGTGAGGGGCTTAGCACCCGG - Intergenic
1124110598 15:26781866-26781888 GCAGTGAGGGGTTTAGCACCTGG - Intronic
1124380350 15:29160118-29160140 GCAGTGAGGGGCTTAGCACCTGG - Intronic
1124387847 15:29224989-29225011 GCAGTGAGGGGCTTAGCATGTGG - Intronic
1124418132 15:29491115-29491137 GCAGTGAGGGGCTTAGTACCTGG - Intronic
1124881561 15:33647511-33647533 GCTGTAAGGGGCATATTACCAGG - Intronic
1125005911 15:34817865-34817887 GCAATAAGGGGCTTAGATCCAGG + Intergenic
1125112214 15:36047075-36047097 GCAGTGAGGGGCTTAGCACCCGG + Intergenic
1125565756 15:40677167-40677189 GTAATGAGGGGCTTAGCACTCGG - Intergenic
1125609697 15:40961738-40961760 GCAATGAGGGACTTAGCACCCGG + Intergenic
1125631598 15:41151802-41151824 GCAGTGAGGTGCTTAGCATCTGG + Intergenic
1125885545 15:43226790-43226812 GCAGTGAGGGGCTTAGCACCCGG - Intergenic
1125914553 15:43474116-43474138 GCAATGAGGGGCTTAGCACCCGG - Intronic
1126088988 15:45034955-45034977 GCAATGAGGGGCTTAGCACCCGG + Intronic
1126128074 15:45314213-45314235 GCAATGAGGGGCTTAGCACCCGG + Intergenic
1126639669 15:50812089-50812111 GCAATGAGGGGCTTAGCACCCGG + Intergenic
1126997582 15:54462575-54462597 GGAGTGAGGGGCTTAGCACCTGG + Intronic
1127553191 15:60061467-60061489 GCAAGGAGGGGGTTAGTTCCGGG - Intronic
1127916443 15:63459206-63459228 GCAGTAAGGGGCTTAGCACCCGG + Intergenic
1127984773 15:64061004-64061026 GCAATGAGGGGCTTAACACCCGG + Intronic
1128110841 15:65075145-65075167 GCAATGAGGGACTTTGCACCCGG + Intronic
1128141058 15:65301311-65301333 ACAGTAAGGGGCTTAGCACCTGG - Intergenic
1128598576 15:68975909-68975931 GCAGTGAGGGGTTTAGCACCCGG - Intronic
1128813311 15:70587414-70587436 GCACTGAGGGGCTTAGCACCCGG - Intergenic
1129158262 15:73732385-73732407 GCAGTGAGGGGCTTAGCACCTGG - Intergenic
1129196937 15:73973872-73973894 GCAGTGAGGGTCTTAGCACCTGG + Intergenic
1129208638 15:74052658-74052680 CAAGTGAGGGGCTTAGCACCTGG + Intergenic
1129264469 15:74386513-74386535 GCAGGGAGGGGCGTTGTAGCAGG + Intergenic
1129280399 15:74480585-74480607 GCAATGAGGGACTTAGCACCCGG - Intergenic
1129374005 15:75116193-75116215 GCAGTGAGGGGCTTAGCACCTGG - Intronic
1129586856 15:76876068-76876090 GCAGTGAGGGGCTTAGCACCTGG - Intronic
1129724389 15:77894213-77894235 GCAGTGAGGGGCTTAGCACCTGG - Intergenic
1129777501 15:78246377-78246399 GCAATGAGGGGCTTAGCACCCGG - Intergenic
1129859161 15:78846994-78847016 GCAATGAGGGACTTAGCACCCGG + Intronic
1129997149 15:80016642-80016664 GCAGTGAGGGGCTTAGCACCTGG + Intergenic
1130132860 15:81158743-81158765 GCAATGAAGGGCTTAGCGCCCGG + Intergenic
1130184285 15:81664688-81664710 GCAGTGAGGGGACTAGTCCAGGG - Intergenic
1130634599 15:85605517-85605539 GCATTGCTGGGCTTAATACCTGG + Intronic
1130785548 15:87091897-87091919 GCAGTGAGGGGCTGTGAACAGGG - Intergenic
1131012703 15:89031897-89031919 GCAGTGAGGGGCTTAGCACCTGG - Intergenic
1131212694 15:90511079-90511101 GCAGTGAGGGGCTTAGAACCTGG + Intergenic
1131250256 15:90825633-90825655 GCAGTGAGGGGCTTAGCACCTGG + Intergenic
1131472828 15:92711258-92711280 GCAGTGAAGGGCTTAGCACCTGG - Intronic
1131846126 15:96492077-96492099 GCAATGAGGGGCTTAGCACCCGG - Intergenic
1131892176 15:96984369-96984391 GCAGTGAAGGGCTTAGCACCCGG - Intergenic
1131912589 15:97224368-97224390 GCAGTGAGGGGCTTAGCACCCGG + Intergenic
1131992379 15:98104463-98104485 GCAGTGAGGGGCTTAGCACCTGG - Intergenic
1132044218 15:98549874-98549896 GCAGTGAGGGGCTTAGCACATGG + Intergenic
1132062365 15:98702989-98703011 GCAGGCAGGGGCTTGGTACCTGG - Intronic
1132097711 15:99000170-99000192 GCAGTGAGGGGCTTAGCATCTGG + Intronic
1132098865 15:99008475-99008497 GCAGTGAGGGGCTTAGCACCTGG - Intergenic
1132155834 15:99494874-99494896 GCAGTGAGGGGCTTAGCACCTGG - Intergenic
1132468864 16:90560-90582 GCAGTGAGGAGCCTTGTGCCAGG + Intronic
1132511014 16:341384-341406 GCAATGAGGGGCTTAGCACCCGG + Intronic
1132834090 16:1943599-1943621 GCAGCTCCGGGCTTAGTACCAGG - Intergenic
1132836826 16:1958439-1958461 GCAATGAGGGGCTTAGCACCCGG - Intergenic
1133352156 16:5108750-5108772 GCAGTGAGGGGCTTAGCACCAGG - Intergenic
1133362646 16:5186562-5186584 GCAGTGAGGAGCTTAGCACCTGG - Intergenic
1133814273 16:9184402-9184424 GCAGTGAGGGGCTTAGCACCTGG - Intergenic
1134236980 16:12474249-12474271 GCAGTGAGGTGCGTAGTGCCTGG + Intronic
1134626911 16:15728932-15728954 GCGGTGAGGGGCTTCTTTCCAGG + Intronic
1134678138 16:16104867-16104889 GTAGTGAGGGGCTTAGCACCTGG - Intronic
1135262125 16:20989880-20989902 GCAATGAGGGACTTAGCACCCGG - Intronic
1135751069 16:25059150-25059172 GCAATGAGGGGCTTAGCACCAGG - Intergenic
1135942688 16:26836295-26836317 GCAGTGAGGGGCTTAGCACCTGG - Intergenic
1136163293 16:28435490-28435512 GCAATGAGAGGCTTAGTACCCGG + Intergenic
1136216018 16:28793670-28793692 GCAATGAGGGGCTTAGTACCCGG - Intergenic
1137442505 16:48508810-48508832 GCAATGAGGGGCTTAGCACCTGG + Intergenic
1138168833 16:54829937-54829959 GCAGTGAGGGACTTAGCACCCGG + Intergenic
1138688774 16:58748975-58748997 GCAGTGAGGGGTTTAGCACCCGG + Intergenic
1138889891 16:61129024-61129046 GCAGTGAGGGGCTCAGCACTCGG - Intergenic
1138945716 16:61847215-61847237 GCATTGCAGGGCTTAGAACCAGG - Intronic
1139019020 16:62724988-62725010 GCATTGAGGGGCTTAGCACCTGG + Intergenic
1139051481 16:63129755-63129777 GCAGTGAGGGGCTTAGCACTTGG + Intergenic
1139125542 16:64072568-64072590 GCAATGAGAGGCTTAGCACCCGG - Intergenic
1139147729 16:64344015-64344037 GCAATGAGGAGCTTAGCACCCGG + Intergenic
1139442308 16:66974391-66974413 GCAGTGAGGGCCTTAGCACCTGG + Exonic
1139600295 16:67982387-67982409 GCAGTGAGGAGCTTAGCACCTGG + Intergenic
1139603048 16:67998335-67998357 GCAATGAGGGGCTTGGCACCCGG + Intronic
1139609941 16:68048726-68048748 TCAGTATGGGGGTTAGTACCAGG + Intronic
1139676423 16:68526868-68526890 GCAGTGAGGGGCTTAGCACCTGG + Intergenic
1140722526 16:77784618-77784640 GCAATGAGGAGCTTAGCACCAGG - Intergenic
1141465751 16:84204855-84204877 ACAATGAGGGGCTTAGCACCCGG - Intergenic
1141837702 16:86553531-86553553 GCAGTGAGGGGCTTAGCACCTGG + Intronic
1142633918 17:1244869-1244891 GCAGCGACGGGCCTAGTGCCAGG + Intergenic
1142828808 17:2532333-2532355 GCAGTGAGGGGCTTAGCACCTGG - Intergenic
1143127983 17:4656749-4656771 GCAGTGAGGGGCTTAGTACCTGG - Intergenic
1143135265 17:4709290-4709312 GCAGTGAGGGGCTTAGCACCTGG - Intergenic
1143283360 17:5771365-5771387 GCAGTGAGGGGCTTAGCACCTGG + Intergenic
1143552743 17:7641001-7641023 GCAGTGAGGGGATTAGCACCAGG + Intergenic
1143664279 17:8347359-8347381 GCAATGAGGGGCTTAGCACCCGG - Intergenic
1143708656 17:8718316-8718338 GCAGTGAGGAGCTTAGCACCCGG - Intergenic
1144128086 17:12221025-12221047 GCAGTGAGGGCCTTAGCACCTGG + Intergenic
1144723205 17:17486474-17486496 GCAATGAGGGACTTAGCACCCGG + Intronic
1144999063 17:19290817-19290839 GCAGTGGTGGGCTTTGTACCAGG + Intronic
1145050314 17:19654555-19654577 GCAATGAGGGGCTTAGCACCTGG - Intronic
1145094846 17:20016591-20016613 GCAGTGAGGGGCTTAGCACCTGG + Intronic
1146004383 17:29151630-29151652 GCACTGAGGGGCTTTCTCCCAGG - Intronic
1146740472 17:35279154-35279176 GGAATGAGGGGCTTAGCACCCGG - Intergenic
1147373620 17:40011055-40011077 GCAATGAGAGGCTTAGCACCCGG + Intergenic
1147431816 17:40375955-40375977 GCAATGAGGGGCTTAGCATCCGG + Intergenic
1147805341 17:43126941-43126963 GCAGTCAGGGGCCTAGCACCCGG + Intergenic
1147997531 17:44368944-44368966 GCAATGAGGGGCTTAGCACCCGG + Intergenic
1148016871 17:44528095-44528117 GCAATGAGGGGTTTAGCACCCGG + Intergenic
1148023376 17:44568337-44568359 GCAGTGAGGGGCTTAGCACCTGG + Intergenic
1148366180 17:47057522-47057544 GCAGTCAGGGGCTTAGCACCCGG - Intergenic
1148445512 17:47734729-47734751 GCAGTGTGGGGCTGGCTACCAGG - Intronic
1148991246 17:51668892-51668914 GCAGTGAGGGGCTTAGCACCTGG + Intronic
1149753972 17:59172643-59172665 GCAGTGAGGGGCTTAGCAACCGG + Intronic
1149916380 17:60613735-60613757 GCAGTGAGGGGCTTAGCACCCGG + Intronic
1150682512 17:67294870-67294892 GCATTGAGGGGCTTAGCACCTGG + Intergenic
1150772280 17:68051993-68052015 GCAGTGAGGGGCTTAGCACCCGG + Intergenic
1150775826 17:68080776-68080798 GCAGCGAGGGGCTTAGCACCTGG + Intergenic
1150778277 17:68099403-68099425 GCAATGAGGGACTTAGCACCCGG + Intergenic
1150786755 17:68169597-68169619 GCAATGAAGGACTTAGCACCCGG - Intergenic
1150792241 17:68207978-68208000 GCAGTGAGAGGCTTAGCACCTGG + Intergenic
1150804610 17:68309149-68309171 GCAATGAGGGGCTTAGAACCCGG - Intronic
1151438515 17:74113571-74113593 ACAGTGAGGGGCTTAGCACCCGG - Intergenic
1151567466 17:74907281-74907303 GCAGTGAGGGGCTTAACACCTGG - Intergenic
1151782681 17:76257887-76257909 GCAATGAGGGGCTTAGCACCCGG - Intergenic
1151813549 17:76459512-76459534 GCAGTGAGGGGCCAAGACCCAGG - Intronic
1151866441 17:76806278-76806300 GCAGTGAGAGGCTTAGCACCTGG + Intergenic
1151983177 17:77526291-77526313 GCAGTGAGGGTCTTAGCACCCGG - Intergenic
1152550584 17:81028056-81028078 GCAGTGCGGGGGTGAGCACCGGG - Intergenic
1152619056 17:81352287-81352309 GCAATGAGGGGCTTAGCACCCGG - Intergenic
1153644060 18:7178905-7178927 GCAATGAGGGACTTAGCACCCGG - Intergenic
1153665042 18:7360762-7360784 GCAGTGAGGGGCTTAGCACCTGG + Intergenic
1153868704 18:9297057-9297079 GCAGTGAGGGGATTAGCACCCGG + Intergenic
1154047147 18:10916523-10916545 GCAGTGAGGGGCTTAGCACTCGG - Intronic
1154057246 18:11023886-11023908 GCAATGAGGGGCTTAGCACCCGG - Intronic
1154097609 18:11432530-11432552 ACAATGAGGGGCTTAGCACCCGG - Intergenic
1154128750 18:11717142-11717164 ACAGTGAGGGGCTTAGCACCTGG - Intronic
1154231157 18:12557387-12557409 GCAGTGAGGGGCTTAGCACCTGG - Intronic
1154255316 18:12777094-12777116 GCAGTGAGGGGCTTAGCACCCGG - Intergenic
1154288867 18:13087095-13087117 ACAGTGAATGGCTTAGTACCTGG + Exonic
1155145252 18:23078079-23078101 GCTGTGAGGGGCCTTGTGCCAGG - Intergenic
1155208054 18:23577870-23577892 GCAATGGGGGACTTAGCACCCGG - Intronic
1155295037 18:24376819-24376841 GCAATGAGGAGCTTAGCACCCGG - Intronic
1155611711 18:27674102-27674124 GCAGTGAAGGGCTTAGCACCTGG - Intergenic
1155772872 18:29723638-29723660 GCAGTGGGGGACTTAGCACCCGG + Intergenic
1155852278 18:30788565-30788587 GTAATGAGGGACTTAGCACCCGG + Intergenic
1155856382 18:30839398-30839420 GTAATGAGGGACTTAGCACCCGG - Intergenic
1155976780 18:32139986-32140008 GCAGTGAGGTGCTTAGCACCTGG + Intronic
1156038666 18:32794695-32794717 GCAATGAGGGACTTAGCACCCGG + Intergenic
1156079504 18:33316341-33316363 GCAGTAAGGGGCTTAGCACCTGG + Intronic
1156150345 18:34234078-34234100 GCAGTGAGGGGCTTAGCACCTGG + Intergenic
1156243046 18:35271886-35271908 GCAGTAAGGGGCTTAGCACCCGG - Intronic
1156610494 18:38718625-38718647 GCAGTGAGGAGCTTAGCACCTGG - Intergenic
1156651935 18:39235450-39235472 GCAGTGAGACACTTAGCACCTGG + Intergenic
1156657822 18:39309214-39309236 GCAGTGAGGGGATTAGCACCCGG + Intergenic
1156863656 18:41865878-41865900 GCAGTGAGGAACTTGGCACCCGG + Intergenic
1156943164 18:42795353-42795375 GCAATGAGGGACTTAGCACCCGG + Intronic
1156969673 18:43139642-43139664 GCAGTGAGGGGCTTAGCACCTGG + Intergenic
1157202769 18:45673070-45673092 GCTGTGAGGGGGTTAGAGCCTGG + Intronic
1157670159 18:49521486-49521508 GCATTGTGGGGCTTAGTAAGAGG - Intergenic
1157856899 18:51112045-51112067 GCAGTGAGGGGCTTAGCACCTGG - Intergenic
1157858371 18:51121158-51121180 GCAGTGAGGGGCTTAGCACCTGG - Intergenic
1157935183 18:51864605-51864627 GCAGTGAGGGGCTCAGCACCTGG - Intergenic
1157979804 18:52367143-52367165 GCAATGAGGGGCTTAGCACACGG - Intronic
1158266436 18:55665011-55665033 GCAGTGAGGGGCTTAGTACCCGG + Intergenic
1158282311 18:55840935-55840957 GCAGTGAGGAGCTTAGTAGCTGG - Intergenic
1158351917 18:56572411-56572433 GCAATAAGGGGCTTAGCACCGGG + Intergenic
1158460731 18:57643854-57643876 GCAGTGAGGGGCTTAGCACCTGG - Intergenic
1158465370 18:57685396-57685418 GCACTGAGGGGCTGAGGACGTGG - Intronic
1158553875 18:58459494-58459516 GCAGTGAGGGGCTTAGCACCCGG + Intergenic
1158597339 18:58827932-58827954 GCAGTGAGGGGCTTAGCACCAGG - Intergenic
1158697264 18:59714332-59714354 GCAGTGAGGGACTTGGCACCCGG - Intergenic
1158705759 18:59790691-59790713 CCAATGAGGGACTTAGCACCCGG - Intergenic
1158975930 18:62711796-62711818 GCAGATAGGGGCTTGGTACTGGG - Intergenic
1159109800 18:64043092-64043114 GCAGTGAGGGGCTTAGCACCTGG + Intergenic
1159167957 18:64725869-64725891 GCAATGAGGGACTTAGCACCCGG - Intergenic
1159230796 18:65605375-65605397 GGAATGAGGGGCTTAGCACCCGG + Intergenic
1159289317 18:66395943-66395965 GCAGTGAGAGGCTCAGCACCTGG + Intergenic
1159322224 18:66866825-66866847 GCATTGAGGGGCTTAGCACCTGG + Intergenic
1159472952 18:68880234-68880256 GCAATGAGGGGCTTAGCACCTGG - Intronic
1159656110 18:71031578-71031600 GCAATGGGGGACTTAGCACCCGG - Intergenic
1159670215 18:71212721-71212743 GAAGTGAGGGGCTTAGCACCTGG - Intergenic
1160176624 18:76600369-76600391 GCAATGGGGGACTTAGCACCCGG - Intergenic
1160198551 18:76777366-76777388 GCAGTGAGGGGCTTAGCACCCGG + Intergenic
1160200070 18:76788772-76788794 ACAGTAAGGGGCTTAGTACCTGG - Intergenic
1160951407 19:1669320-1669342 GCGGTGAGGGGGTGAGGACCGGG + Intergenic
1162106993 19:8375881-8375903 GCAATGAGGGGCTTAGCACCCGG + Intronic
1162230141 19:9259634-9259656 GCAATGAGGGGCTTAGCACCCGG + Intergenic
1162233115 19:9283693-9283715 GCAATGAGGGGCTTAGCAACCGG - Intergenic
1162237640 19:9321514-9321536 GCAATGAGGGTCTTAGCACCCGG + Intergenic
1162263045 19:9547928-9547950 GCAGTGAGGGGCTTAGCACCTGG + Intergenic
1162632706 19:11941535-11941557 GCAATGAGGGGCTTAGCACCTGG - Intronic
1162814730 19:13186944-13186966 GCAATGAGGGGCTTAGCACCCGG - Intergenic
1162987100 19:14277746-14277768 GCAGTGAGGGGCTTGGCACCCGG + Intergenic
1163181725 19:15608884-15608906 GCAATGAGGGACTTAGCACCCGG - Intergenic
1163218843 19:15899804-15899826 GCAATGAGGGGCTTAGCACCCGG + Intergenic
1163632958 19:18426437-18426459 GCAGGGAGCGGCTCAGTTCCAGG + Intronic
1164144032 19:22499228-22499250 GCAATGAGGGGCTTAGCACCTGG - Intronic
1164270590 19:23668766-23668788 GCAATGAGGGACTTAGCACCCGG - Intronic
1164291940 19:23877302-23877324 GAAGTGAGGGGCTCAGTGCCGGG - Intergenic
1164310457 19:24041435-24041457 GCAATGGGGGACTTAGCACCCGG + Intronic
1164581966 19:29440140-29440162 GCAGTGAAGTGCTTAGCACCCGG + Intergenic
1164975790 19:32571709-32571731 GCAATGAGGGACTTAGCACCCGG + Intergenic
1165036388 19:33036759-33036781 GCAGTGAGGGGCTTAGCACCTGG + Intronic
1165266935 19:34668314-34668336 GCAGTGAGGGGCTTAGCACCTGG + Intronic
1165415527 19:35691298-35691320 GCAGTGAGGGGCTTAGCACCTGG - Intergenic
1165846578 19:38821617-38821639 GCAGTGAGGGGCTTAGCACCTGG + Intronic
1166036225 19:40170380-40170402 GCAATGAGGGGCTTAGCGCCTGG - Intergenic
1166649727 19:44563444-44563466 GCAATGGGGGACTTAGCACCCGG - Intergenic
1168659884 19:58157424-58157446 GCAGTGAGGGGCTTACCACCCGG + Intergenic
924967372 2:91112-91134 GCCGTGAGGAGCTTAGCACCTGG + Intergenic
924977482 2:191597-191619 GCAGTGAGGGGCTTAGCATCTGG - Intergenic
925098980 2:1229838-1229860 GCAATAAGGGACTTAGCACCCGG - Intronic
925172602 2:1759536-1759558 GCAGTGAGGGGCTTAGCACCTGG - Intergenic
925532969 2:4884327-4884349 GCTGTGAGGGGCTTAGCACCCGG + Intergenic
925537814 2:4935553-4935575 GCAATGAGGGACTTAGCACCCGG - Intergenic
926097488 2:10091538-10091560 GCAGTAAGGGGCTTAGCACCCGG + Intergenic
926437672 2:12854311-12854333 GCAGTGAGGGGTTTAGCACCTGG - Intergenic
926444532 2:12926749-12926771 GCAGTGAGGGGCTTAGCACCTGG - Intergenic
926474775 2:13308531-13308553 GCTGTGAAGAGCTTAGCACCTGG - Intergenic
926616638 2:15002774-15002796 GCAATGAGGGGCTTAGCACCCGG - Intergenic
926631775 2:15143166-15143188 GTAGAAAGGGGCTGAGTACCTGG - Intergenic
926850659 2:17193675-17193697 GCAATGAGGAGCTTAGCACCTGG + Intergenic
927357082 2:22186463-22186485 GCAGTGAGGGGCTTAGCACCTGG + Intergenic
927469644 2:23363353-23363375 GCAGAGAGTGGGTTAGTACCAGG - Intergenic
927777802 2:25915625-25915647 GCAATGAGAGGCTTAGCACCTGG + Intergenic
927900428 2:26814591-26814613 GCTGTGAGGGGCTTAGCACCTGG + Intergenic
927938307 2:27087436-27087458 GCAGTGAGGCCCTGAGAACCCGG + Intronic
927942185 2:27111707-27111729 GCAGTGAGGGGCTTAGCACCTGG - Intronic
927970871 2:27305857-27305879 GGAGTCAGGGCCTTGGTACCTGG + Intronic
928106363 2:28472792-28472814 GCAGTGAGGGGCTTAGCACCTGG + Intronic
928593673 2:32841071-32841093 GCAGAGTGGGGCTTGGAACCGGG + Intergenic
928599198 2:32886807-32886829 GCAGTGAGGAGCTTAGCACCCGG - Intergenic
928617945 2:33057667-33057689 GCAGTGAGGGGCTTAGCACCTGG - Intronic
928701543 2:33903757-33903779 GCAGTGAGGGGCTTAGCACCTGG - Intergenic
928880571 2:36092362-36092384 GCAGTGATGGGCTTAGCACCCGG + Intergenic
928936893 2:36688382-36688404 GCAATGAGGGGCTTAGCACCCGG + Intergenic
929109860 2:38397406-38397428 GCAGTGAGGGGCTTAGCACCTGG + Intergenic
929138023 2:38643300-38643322 GCAGTGAGGGGCTTAGCACCCGG - Intergenic
929201852 2:39244396-39244418 GCAATGAGGGACTTAGCACCCGG + Intergenic
929233707 2:39585476-39585498 GCAGTGGGGGGCTTAGCACCCGG + Intergenic
929379683 2:41335711-41335733 GCAGTGAGGGACTTGGCACCCGG + Intergenic
929588470 2:43130596-43130618 GAGGTGAGGGGCTGAGTCCCAGG + Intergenic
929890875 2:45917910-45917932 GCAATGAGGGGCTTAGCACCGGG - Intronic
930039209 2:47107401-47107423 GCAACGAGGGGCTTAGCACCCGG + Intronic
930338763 2:50084448-50084470 GCAGTGATGGGCTTAGCACCAGG - Intronic
930420891 2:51151858-51151880 GCAGTGAGGGGCTTAGAACCCGG - Intergenic
930468221 2:51780526-51780548 GCAATGAGAGGCTTAGCACCCGG - Intergenic
930485502 2:52006920-52006942 GCAGTGAGGGACTTGGCACCCGG + Intergenic
931106970 2:59067049-59067071 GGAGTGAGGGGCTTAGCACCCGG + Intergenic
931708687 2:64969125-64969147 GCAATGAGGGGCTTAGCACCCGG + Intergenic
932359525 2:71092727-71092749 GCAGTGAGTGGCTTAGCACCCGG - Intergenic
932486471 2:72087002-72087024 GCAATGGGGGACTTAGCACCCGG + Intergenic
932521766 2:72421948-72421970 GCAATGAGGGACTTAGCACCCGG + Intronic
932902045 2:75711695-75711717 GCAGTGAGGGACTTGGCACCCGG + Intergenic
932983477 2:76698363-76698385 GCATTGAGGAGCTTAGCACCTGG - Intergenic
933060835 2:77734979-77735001 GCAGTGAGGGGCTTAGCACCTGG - Intergenic
933415811 2:81985279-81985301 GCAGTGAGAGGCTTAGCACCCGG + Intergenic
933442079 2:82326446-82326468 GCAGTGAGGGGCTTAGCACCTGG - Intergenic
933487262 2:82938685-82938707 GCAATGAGGGACTTAGCACCCGG - Intergenic
933506326 2:83181163-83181185 GAAGTGAGGGGCTTAGCACCTGG + Intergenic
933511464 2:83246165-83246187 GCAGTGAGGGGCTTAGCACCTGG - Intergenic
933531631 2:83518292-83518314 GCAGTGAGGGGCTTAGCACCCGG + Intergenic
934085129 2:88503259-88503281 GAAGTGAGGGGCTTAGCACCTGG + Intergenic
935790297 2:106584510-106584532 GCAGTGAGGGGCTTAGCACCCGG + Intergenic
935878367 2:107536330-107536352 GCAGTGAGGGGCTTAGCACCCGG - Intergenic
935896857 2:107747578-107747600 GCAATGAGGGGCTTAGCACCCGG - Intergenic
935922548 2:108031684-108031706 GCAGTGAGGGGCTTAGCAGCTGG + Intergenic
936172702 2:110190428-110190450 GCAGTGAGGGGCTTAGCACCTGG - Intronic
936581527 2:113704644-113704666 GCAATGAGGGGCTTAGCACCCGG - Intergenic
936865414 2:117071821-117071843 GCAGTGAGGGGCTTAACACCCGG - Intergenic
937181136 2:119997104-119997126 GCAATGAGGAGCTTAGCACCCGG + Intergenic
937608206 2:123826984-123827006 GCAGTGAGGGGCTTAGCACCCGG - Intergenic
937746592 2:125422369-125422391 GCAATGAGGGACTTAGCACCCGG + Intergenic
937751435 2:125479407-125479429 GCAGTGAGGAGCTTAGCACCCGG - Intergenic
938401024 2:130991566-130991588 GCAATGAGGGAATTAGCACCCGG + Intronic
938726034 2:134109585-134109607 GCAATGAGGGGCTTAGCACCTGG - Intergenic
938931205 2:136088263-136088285 GAAGTGAGGGGCTTAGCACCTGG - Intergenic
939003137 2:136758580-136758602 GCAGTGAGGGGCTTAGCACCTGG + Intergenic
939053218 2:137331847-137331869 GCAATGAGGGGCTTAGCACCCGG - Intronic
939085671 2:137715917-137715939 GCAGTGAGGGGCTTAGCACCCGG + Intergenic
939229754 2:139410461-139410483 GCAATGAGGGGCTTAGCACCCGG + Intergenic
939275211 2:139990939-139990961 GCAATGAGGAGCTTAGCACCCGG - Intergenic
939465124 2:142546181-142546203 GCAATGAGGGACTTAGCACCTGG + Intergenic
939777361 2:146403931-146403953 GCAATGAGGGACTTAGCACCCGG - Intergenic
939886434 2:147686491-147686513 GCAGTGAGGGGCTTAGCACCTGG - Intergenic
939898908 2:147826980-147827002 GCAGTGAATGGCTTAGCACCCGG + Intergenic
939972547 2:148678640-148678662 GCAATGAGGGGCTTAGCACCCGG - Intronic
940112648 2:150171267-150171289 GCAGTGAGGGGCTTAGCACCTGG - Intergenic
940215096 2:151296120-151296142 GCAGTGAGGGGCTTAGCACCTGG + Intergenic
940361938 2:152805060-152805082 GCAGTGAGGGGCTTAGCACCTGG - Intergenic
940666711 2:156618297-156618319 GCAATGAGGGGCTTAGCACCCGG - Intergenic
940784601 2:157968110-157968132 GCAGTGAGGGGCTTAGCACCTGG - Intronic
941240080 2:163026396-163026418 GCAATGAGGGGCTTAGCACCCGG + Intergenic
941397934 2:164994994-164995016 GCAAGGAGGGGCTTAGCACCTGG - Intergenic
941705875 2:168657678-168657700 GCAATGGGGGACTTAGCACCCGG - Intronic
941712127 2:168725137-168725159 GCAATGAGGGGCTTAGCACCCGG - Intronic
941820787 2:169841654-169841676 GCAATGGGGGACTTAGCACCCGG + Intronic
941878611 2:170459864-170459886 GCAGTGAGGGGCTTAGTATCTGG - Intronic
942170261 2:173282828-173282850 GCAGTGAGGGGCTTAGCACCCGG - Intergenic
942299595 2:174548791-174548813 GCAGTGAGGGGCTTAGCATCTGG - Intergenic
942317606 2:174709816-174709838 GCAGTGAGGGGCTTAGCACCTGG - Intergenic
942540181 2:177007972-177007994 GCAATGAGGGGCTTAGCGCCCGG + Intergenic
942620018 2:177835794-177835816 GCAGTGAGGGACTTAGCACCCGG + Intronic
942867285 2:180691508-180691530 GCAATGAGGGGCTTAGCACCCGG + Intergenic
943024218 2:182608568-182608590 GCAGTGAGGGGCTTAGCACCTGG + Intergenic
943106158 2:183546886-183546908 GCACTGAGGGGCTTAGCACCTGG - Intergenic
943134433 2:183892655-183892677 GCAGTGAGGGTCTTAGCACCTGG + Intergenic
943166072 2:184327888-184327910 GCAGTAAGGGGCTTAGCACCTGG - Intergenic
943443285 2:187951835-187951857 GCAGTGAGGGGCTTAGCACCTGG + Intergenic
943494760 2:188606635-188606657 GCAATGAGGGGCTTAGCACCCGG - Intergenic
943680347 2:190761194-190761216 GCAATGAGGGGCTTAGCACCCGG - Intergenic
943790042 2:191921751-191921773 GCAGTGAGGGGCTTAGCACCTGG + Intergenic
943906116 2:193502649-193502671 GCAGTGAGGGGCTTAGAACCTGG - Intergenic
943941446 2:194002977-194002999 GCAGTGAGGGGCTTAGCACCTGG - Intergenic
943942720 2:194020282-194020304 GCAGTGAGGGGCTTAGGACCCGG + Intergenic
943947869 2:194090633-194090655 GCAGTGAAGGGCTTAGCACCCGG - Intergenic
944055187 2:195515797-195515819 GTAGCGACGGGCTTAGCACCTGG + Intergenic
944482802 2:200174902-200174924 GCAGTGAGGGGCTTAGCACCTGG + Intergenic
944728594 2:202497031-202497053 GCAATGAGGGGCTTAGCACCCGG + Intronic
944843139 2:203643069-203643091 GCAGTGAGAGGCTTAGCACTTGG - Intergenic
945069642 2:205977347-205977369 GCAGTGAGGGGCTTAGCACCTGG + Intergenic
945401393 2:209387499-209387521 GCAGTGAGGGGCTTAGCACCTGG + Intergenic
945451487 2:210000813-210000835 GCAGTGAGGGGCTTAGCACCTGG - Intergenic
945575481 2:211524617-211524639 GCAATGAGGGGCGTAGCACCCGG - Intronic
945664234 2:212721308-212721330 GCAGTGAGAGGCTTAGCACCTGG - Intergenic
945745777 2:213718612-213718634 GCAATGGGGGACTTAGCACCCGG + Intronic
945869145 2:215207994-215208016 GCAGTGAGGGGCTTAGCACCCGG + Intergenic
945872831 2:215245968-215245990 GCAGTGAGGGGCTTAGCACCCGG - Intergenic
946053994 2:216885369-216885391 GCAGTGAGGAGCTTAGCACGTGG + Intergenic
946152773 2:217787505-217787527 GCAGTGGGGGGCTTAGCACCTGG - Intergenic
946226355 2:218266005-218266027 GTAGGGAGGGGCTGAGAACCTGG - Intronic
946358088 2:219201667-219201689 GCAATGGGGGACTTAGCACCCGG - Intronic
946376508 2:219312941-219312963 GCAGTGAGGGGCTTAGCACCTGG + Intergenic
946923573 2:224603941-224603963 GCAATGAGGGACTTAGCACCCGG - Intergenic
946982172 2:225229688-225229710 GCAATGAGGGGCTTAGCACCCGG - Intergenic
947026623 2:225744254-225744276 GCTATGAGGGGCTTAGCACCCGG + Intergenic
947094184 2:226547367-226547389 GCAATGATGGTCATAGTACCAGG + Intergenic
947411989 2:229850838-229850860 GCAATGAGGGGCTCAGCACCCGG + Intronic
947539360 2:230964476-230964498 GCAGTGACGAGCTTAGCACCTGG - Intergenic
947562269 2:231166353-231166375 GCAGAGAGAGATTTAGTACCTGG - Intronic
947720418 2:232366461-232366483 GCAATGAGGGGCTTAGCACCCGG + Intergenic
947932063 2:233972708-233972730 GCAATGAGAGGTTTAGCACCCGG - Intronic
947962035 2:234247795-234247817 GCAGTGAGGGGCGTAGCACCCGG + Intergenic
948058802 2:235028851-235028873 GGTGGGAGGGGCTTGGTACCTGG + Intronic
948449115 2:238058093-238058115 GCAATGAGGGGCTTAGCACCCGG - Intronic
948602262 2:239114065-239114087 TCAGTGTGGGGCCTTGTACCTGG - Intronic
948820094 2:240538401-240538423 GCAGTGAGGGGCTTAGCACCTGG + Intronic
1169511240 20:6266534-6266556 GGAGGGAGAGGCTTAGTAACAGG - Intergenic
1169630239 20:7622685-7622707 GCAGTGAGGGGCTTACCACCAGG - Intergenic
1169645349 20:7803757-7803779 GCAGTGAGGGGCTTAGCACCTGG - Intergenic
1169849188 20:10031802-10031824 GCAATGAGAGGCTTAGCACCCGG + Intronic
1170230872 20:14045023-14045045 GCAGTGAAGGGCTTAGCACCTGG - Intronic
1170246463 20:14226628-14226650 GCAATGAGGGGCTTAGCACCCGG + Intronic
1170806854 20:19639870-19639892 GTAATGAGGGGCTTAGCACCTGG - Intronic
1170930876 20:20768556-20768578 GCAGTGAGGGGCTTAGTACCTGG + Intergenic
1170989880 20:21291992-21292014 GCAATGAGGGACTTAGCACCCGG + Intergenic
1171318856 20:24220960-24220982 GCAATGAGGGACTTAGCACCCGG - Intergenic
1171455730 20:25271095-25271117 GCAGTGGGGGGCTTCGTGCTTGG + Intronic
1171973432 20:31578802-31578824 GCAGTGAGGGGCTTAGCACCCGG - Intergenic
1172094880 20:32455749-32455771 GCAGTGGGAGGCCTCGTACCTGG + Intronic
1172431862 20:34899042-34899064 GCAATGAGGGGCTTAGCACCCGG - Intronic
1173195531 20:40910709-40910731 GCAATGAGGGACTTAGCACCTGG - Intergenic
1173195681 20:40911304-40911326 GCAATGAGGGACTTAGCACCCGG + Intergenic
1173778761 20:45736018-45736040 GCAATGAGGGGCTTAGCACCTGG + Intergenic
1174162884 20:48564304-48564326 GCAGTGAGGGGCTTACCACCTGG - Intergenic
1175210063 20:57348517-57348539 GCAATGAGGGGCTTGGCACCCGG + Intergenic
1175254147 20:57628915-57628937 GCAATGAGGGACTTAGCACCCGG + Intergenic
1176189376 20:63800666-63800688 GCAATGAGGGGCTTAGCACCCGG + Intronic
1176344829 21:5733713-5733735 GCAGTGAGGGGCTTAGCACCTGG - Intergenic
1176351643 21:5854297-5854319 GCAGTGAGGGGCTTAGCACCTGG - Intergenic
1176499998 21:7590742-7590764 GCAGTGAGGGGCTTAGCACCTGG + Intergenic
1176539150 21:8131783-8131805 GCAGTGAGGGGCTTAGCACCTGG - Intergenic
1176558101 21:8314828-8314850 GCAGTGAGGGGCTTAGCACCTGG - Intergenic
1176663220 21:9660155-9660177 GCAGTCAGGGGCTTAGCACCTGG + Intergenic
1176663722 21:9664308-9664330 AGAGTGAGGGGCTTGGCACCTGG - Intergenic
1176966622 21:15218815-15218837 GCAATGGGGGACTTAGCACCCGG - Intergenic
1177182397 21:17757828-17757850 GCAATGAGGGGCTTAGCACCTGG - Intergenic
1177318719 21:19493704-19493726 GCAGTGAGGGGCTTAGCACCTGG + Intergenic
1177549094 21:22597922-22597944 GAAGGGAGGGGCTTAGCACCCGG + Intergenic
1177637615 21:23807137-23807159 GGAATGAGGGACTTAGCACCCGG + Intergenic
1177795901 21:25778477-25778499 GCAGTGAGGGGCTTAGCACCTGG + Intergenic
1178052026 21:28758518-28758540 GCAGTGAGGAGCTCAGCAACTGG + Intergenic
1178074180 21:29000301-29000323 GCAGTGAGGGGCTTAGCACCTGG + Intergenic
1178316039 21:31567602-31567624 GCAGTAAAGAACTTAGTACCTGG + Intergenic
1178326993 21:31654314-31654336 GCAATGAGGGGCTTAGCACCAGG + Intergenic
1178398738 21:32265452-32265474 GCAATGGGGGACTTAGCACCTGG + Intergenic
1178585650 21:33868556-33868578 GCAATGAGGGACTTAGCACCCGG - Intronic
1178983356 21:37283424-37283446 GCAATAAGGGACTTAGCACCCGG - Intergenic
1179522588 21:41954474-41954496 GCAAGGAGGGGCTCAGCACCAGG + Intergenic
1180741049 22:18053596-18053618 GCAATGAAGGGCTTAGCCCCCGG - Intergenic
1180755095 22:18155648-18155670 GCAGTAAGGGGCTTAGCACTTGG + Intronic
1180962025 22:19766477-19766499 GCAGCGAGGGGCTTAGCACCCGG - Exonic
1181077669 22:20392605-20392627 GCAGTGAGGGGCTTAGCACCTGG - Intergenic
1181450541 22:23017255-23017277 GCAGTGAGGGGCTTAGCACCTGG - Intergenic
1181581244 22:23829272-23829294 GCAGTTGGGGGCATAGAACCTGG + Intronic
1182338026 22:29598262-29598284 GCAGTGAGGGGCTTAGCACCTGG - Intergenic
1182479382 22:30596985-30597007 GCAGTGAGGGGCTTAGCACCGGG + Intronic
1183422127 22:37718079-37718101 GCAATGAGGGGCTTAGCACCTGG - Intronic
1183685236 22:39357720-39357742 GCAATGAGGGACTTAGCGCCCGG + Intronic
1183990352 22:41593642-41593664 GCAGTGAAGGGCTTAGCAGCCGG + Intergenic
1184069344 22:42138403-42138425 GCAGTGAGGGGCTTAGCACCTGG + Intergenic
1184584250 22:45436849-45436871 GCAGTGAGGAGCTTAGCACCCGG + Intergenic
1184906259 22:47488546-47488568 GCAGTGAGGCGCTTAGCACCCGG - Intergenic
1185229133 22:49670441-49670463 GCAGTGAGGGCCTTAGCACCCGG - Intergenic
1185245275 22:49769920-49769942 GCAGTGAGGAGCTGAGCCCCAGG - Intergenic
1185375101 22:50479012-50479034 GAAATGAGGGGCTCAGTTCCCGG - Intergenic
1203244100 22_KI270733v1_random:48138-48160 GCAGTGAGGGGCTCAGCACCTGG - Intergenic
949281484 3:2352513-2352535 GCAGCGAGAGGCTTAGCACCTGG + Intronic
949769987 3:7568717-7568739 GCAATGAGGGGCTTAGCACCCGG + Intronic
950068950 3:10136632-10136654 GCAGTGAGGGGCTTATCACCTGG - Intergenic
950203594 3:11061494-11061516 GCAGTGAGGGGCTTAGCACCCGG + Intergenic
950207889 3:11094157-11094179 GCAGTGAGGGGCTTAGCACCCGG + Intergenic
950256658 3:11511835-11511857 GCAGTGGGGGACTTAGCACCTGG - Intronic
950401016 3:12769107-12769129 GCAGTGAGGGGCTTAGCACCCGG - Intronic
950418555 3:12883010-12883032 ACAGTGAGGGGCTTAGCACCTGG + Intergenic
950470169 3:13179876-13179898 GCAGTGAGGGGTTTAGCACCTGG + Intergenic
950513370 3:13447436-13447458 GTAATGAGGGACTTAGCACCCGG - Intergenic
950600383 3:14029734-14029756 GCAATGAGGGGCTTAGCACCCGG - Intronic
950601221 3:14037319-14037341 GCAATGAGGGGCTTAGCACCTGG + Intronic
950632644 3:14293332-14293354 GCAGTGAGGGGCTTAGCACCTGG + Intergenic
950672313 3:14534725-14534747 GCAGCGTGGGCCTGAGTACCAGG - Intronic
950863990 3:16174559-16174581 ACAGTGAGGGCATTAGGACCAGG + Intergenic
950929392 3:16773837-16773859 GCAATAAGGGGCTTAGCACCAGG + Intergenic
950943321 3:16917080-16917102 ACAGAAAGGGGCTAAGTACCAGG - Intronic
951024862 3:17817925-17817947 GCAGTGAGGGACTTAGCACCTGG - Intronic
951323207 3:21271861-21271883 GCAGTGAGGGGCTTAGCACCTGG - Intergenic
951332948 3:21387449-21387471 GCAGTGAGGGGCTTAGCACCTGG - Intergenic
951415437 3:22417073-22417095 GCAGTGAGGGGCTTAGCACCTGG + Intergenic
951734797 3:25851884-25851906 CCAGTGAGGGGCTTAGCAGCTGG + Intergenic
951951092 3:28200652-28200674 ACAATAAGGGGCTTAGCACCCGG - Intergenic
952011282 3:28903405-28903427 GCAGTAAGGGGCTTAGCACCTGG - Intergenic
952058094 3:29473741-29473763 GCAATGAGCGGCTTAGTACCTGG - Intronic
952275244 3:31870240-31870262 GCAGTGAGGGGCTTAGCACCTGG + Intronic
952355384 3:32578873-32578895 GCAATGAGGGGCTTAGCACCTGG + Intergenic
952360469 3:32625765-32625787 GCAATGAGGGGCTTAGCATCTGG + Intergenic
952393710 3:32902915-32902937 GCAGTGAGGGGCTTAGCACCCGG + Intergenic
952398227 3:32939804-32939826 GCAGTGAGGGGCTTAGCACCCGG + Intergenic
952593632 3:34988497-34988519 GCAGTGAGGGGTTTAGCACCCGG + Intergenic
952713318 3:36453466-36453488 GCAGTGAGGGTCTTAGCACCTGG + Intronic
952795244 3:37233124-37233146 GCAATAAGGGGCTTAGCACCCGG + Intergenic
953002886 3:38951272-38951294 GCAGTGAGGGGCTTGGCACCCGG + Intergenic
953096269 3:39779866-39779888 GCAGTGAGGGGCTTAGCACCCGG + Intergenic
953124518 3:40078166-40078188 GCAATGAGGGGCTTAGCACCCGG - Intronic
953184145 3:40622407-40622429 TGAGTGCTGGGCTTAGTACCTGG - Intergenic
953307614 3:41844408-41844430 GCAATGAGGAGCTTAGCACCTGG - Intronic
953423025 3:42769831-42769853 GCAGTGAGGAGCTTAGCACCTGG + Intronic
953522497 3:43656666-43656688 GCAATGAGGGACTTAGCATCCGG - Intronic
953674070 3:44986325-44986347 GCAGTGAGGGGCTTAGCACCTGG - Intronic
953714599 3:45306790-45306812 GCAGTGAAGGGCTTAGCACCCGG + Intergenic
954041004 3:47887327-47887349 GCAATGGGGGACTTAGCACCCGG + Intronic
954089328 3:48272162-48272184 GCATTAAGGGGCTTAGCACCCGG - Intronic
954226193 3:49182862-49182884 GCAGTGAGGGGCTTAGCACCTGG - Intronic
954230567 3:49213680-49213702 GCAGTGAGGGGCCTAGCACCTGG - Intronic
954239785 3:49284447-49284469 ACAGTGAGGAGCTGCGTACCAGG + Exonic
954620125 3:51990693-51990715 GCAATGAGGGGCTTAGCACCCGG + Intergenic
955183347 3:56692000-56692022 GCAATGAGGGGCTTAGCACCCGG + Intergenic
955186423 3:56719053-56719075 GCAATGAGGGGCTTAGCACCCGG + Intergenic
955210281 3:56934586-56934608 GCAATGAGGGACTTAGCACCCGG + Intronic
955219659 3:57012986-57013008 GCAGTGAGGGGCTTAGCACCCGG + Intronic
955266463 3:57449585-57449607 GCAATGAGGGACTTAGCACCTGG - Intronic
955449480 3:59050979-59051001 GCAATGAGGGACTTAGCACCCGG + Intergenic
955855639 3:63270118-63270140 GCATTGAGGGGCTTTGTATTAGG + Intronic
956195745 3:66651691-66651713 GCAGTGAGGGGCTTAGCACCTGG + Intergenic
956392191 3:68785514-68785536 GCAGTGAGGGGCTTAGCACCTGG - Intronic
956479613 3:69660787-69660809 GCAGTGAGGGGCTTAGCACCCGG + Intergenic
956563634 3:70611976-70611998 GCAGTGAGGGGCTTAGCACCTGG + Intergenic
956632599 3:71331252-71331274 GCAGTGAGGGGCTTAGCACCTGG + Intronic
956855252 3:73269314-73269336 GCAATGAGGGACTTAGCACCCGG + Intergenic
956986972 3:74712185-74712207 GCAGTGAGGGGCTCAGCACCTGG + Intergenic
957002263 3:74900173-74900195 GCAGTGAGGGGCTTAGCACCTGG - Intergenic
957009187 3:74985365-74985387 GCAATGAGGGGCTTAGCACCTGG - Intergenic
957209436 3:77240326-77240348 GCAGTGAGGGGCTTAGCACCTGG - Intronic
957386446 3:79502374-79502396 GCAGTGAGGGGCTTAGCACCTGG + Intronic
957446131 3:80314614-80314636 GCAGTGAGGGGCTTAGCACCTGG + Intergenic
957560169 3:81812248-81812270 GCAATGAGGGGCTTAGCACCTGG - Intergenic
957630944 3:82715449-82715471 GCAATGAGGGGCTTAGCACCTGG + Intergenic
957665185 3:83217850-83217872 GCAATGAGGGGCTTCGCACCCGG - Intergenic
957804911 3:85134100-85134122 GCAATGAGGGGCTTAGCACCTGG - Intronic
957830021 3:85504915-85504937 GCAATGAGGGGCTTAGCACCCGG - Intronic
957885497 3:86282360-86282382 GCAGTGAGGGGCTCAGCACCGGG + Intergenic
957919665 3:86731687-86731709 GCAGTGAGGGGCTTAGCAGCTGG - Intergenic
957921815 3:86757718-86757740 GCAATGAGGGGCTTAGCACCCGG + Intergenic
957970386 3:87375440-87375462 GCAGTGACGGGCTTAGCACCCGG + Intergenic
957995098 3:87679219-87679241 GCAATGGGGGACTTAGCACCCGG + Intergenic
958022630 3:88015810-88015832 GCAATGAGGGGCTTAGCACCTGG + Intergenic
958419870 3:93917707-93917729 GCAATGAGGGGCTTAGCACCCGG + Intronic
958548598 3:95588778-95588800 GCAGTGAGGGGCTTAGCACCGGG - Intergenic
958549650 3:95595720-95595742 GGAGTGAGGGGCTTACCACCTGG - Intergenic
958810757 3:98858163-98858185 GCAGTGAGGTGCTTAGCACCTGG - Intronic
959027898 3:101262566-101262588 GTAGTGTGGGGATGAGTACCAGG - Intronic
959323335 3:104906258-104906280 GCAGTGAGGGGCTTAGCACCTGG + Intergenic
959462450 3:106643891-106643913 GCAGTGAGGGGCTTACCACCCGG + Intergenic
960149808 3:114238529-114238551 GCAATGAGGGGCTTAGCACCCGG - Intergenic
960199403 3:114812893-114812915 GCAGTGAGGGGCTTAGCACCTGG - Intronic
960227540 3:115185126-115185148 GCAATGAGGGGCTTAGCACCTGG - Intergenic
960282134 3:115791683-115791705 GAAATGAGGGGCTTAGCACCCGG + Intergenic
960560044 3:119073641-119073663 GCAGTGAGGGGCTTAGCACCTGG - Intronic
960761678 3:121078793-121078815 GCAATGAAGGGCTTAGCACCTGG - Intronic
960868592 3:122227417-122227439 GCAGTGAGGGGCTTAGCACCTGG - Intronic
961268774 3:125671798-125671820 GCAGTGACGGGCTTAGCACCCGG + Intergenic
961280007 3:125758819-125758841 GCAGTGAGGGGCTTGGCACCTGG - Intergenic
961298230 3:125904054-125904076 GCAGTGAGGGGCTTAGCACCTGG + Intergenic
961460458 3:127046798-127046820 GCAATGAGGGACTTAGCACCCGG + Intergenic
961461961 3:127056347-127056369 GCAGTGAGGGGCTTGGCACCTGG - Intergenic
961465044 3:127076481-127076503 GCAGTGAGGGGCTTAGCACCTGG - Intergenic
961746727 3:129068522-129068544 GCAGTGAGGGGCTTAGCACCTGG - Intergenic
961932323 3:130547299-130547321 GCAGTGAGGGGCTTAGCACCTGG - Intergenic
962177247 3:133167631-133167653 GCAGTGAGGGGCTTAGCACCTGG - Intronic
962283755 3:134070500-134070522 GTAATGAGGGACTTAGCACCCGG - Intronic
962383769 3:134916599-134916621 GCAGTGAGGGGCTTAGCACCCGG - Intronic
962591077 3:136890237-136890259 ACAGTGGGGGGCTTAGCACCCGG - Intronic
962600507 3:136987827-136987849 GCAATGAGGGGCTTAGCACCCGG - Intronic
962671701 3:137714762-137714784 GCAGTGAGGGGTTTAGCACCCGG - Intergenic
962758247 3:138484770-138484792 GTAATGACGGGCTTAGCACCTGG + Intergenic
962998137 3:140651544-140651566 GCAGTGAGGGGCTTAGCACCTGG + Intergenic
963397207 3:144749933-144749955 GCAATGAGGGACTTAGCACCCGG + Intergenic
963440399 3:145333499-145333521 GCAATGAGGGGCTTAGCACCCGG + Intergenic
963509156 3:146225671-146225693 GCAATGAGGGACTTAGCTCCTGG - Intronic
963583331 3:147154207-147154229 GCAGTGAGGGACTTAGCACCTGG + Intergenic
963589977 3:147245805-147245827 GCAGTGAGAGGCTTAGCACCTGG - Intergenic
963651831 3:147989620-147989642 GAAATGAGGGGCTTAGCACGCGG - Intergenic
963673504 3:148280760-148280782 GCAGTGAGGGGCTTAGCACCCGG - Intergenic
963743006 3:149098089-149098111 GCAGTGAGGGGCTTAGCACCTGG - Intergenic
963744161 3:149109509-149109531 GCAGTGAGGGGCTTAGCACCTGG + Intergenic
963862166 3:150323089-150323111 GCAATGAGGGGCTTAGCACCCGG + Intergenic
964014375 3:151928276-151928298 GCAATGAGGGGCTTAGCACCCGG + Intergenic
964032315 3:152152537-152152559 GCAATGAGGGGCTTAGCACCCGG + Intergenic
964037538 3:152217423-152217445 GCAATGAGGGGCTTAGCATCTGG + Intergenic
964064060 3:152559556-152559578 ATAGTGAGGGGCTTAGCATCTGG + Intergenic
964139221 3:153378575-153378597 GCAATGGGGGACTTAGCACCCGG - Intergenic
964198155 3:154088133-154088155 GCAGTGAGGGGCTTAGCACCTGG + Intergenic
964265383 3:154889479-154889501 GCAGTGAGGGACTTAGTAACTGG - Intergenic
964375055 3:156041440-156041462 GCAGTGAGGGGCTTAGCACCTGG + Intronic
964376257 3:156051887-156051909 GCAGTGAGGGGCTTAGCACCTGG + Intronic
964378524 3:156073281-156073303 TTAGTGAGGGGCTTAGCACCTGG + Intronic
964381100 3:156099588-156099610 GCAGTGAGGGGCTTAGCACCTGG + Intronic
964444000 3:156740699-156740721 GCAATGAGGGGCTTAGCACCTGG + Intergenic
964517841 3:157531941-157531963 TCAGTGAGGGGCTGGGTACTTGG - Intronic
964751857 3:160060645-160060667 GCAGTGAGGGGCTTAGCACCCGG + Intergenic
964802887 3:160574184-160574206 GCAGTGAGGGGCTTAGCACCTGG - Intergenic
964974168 3:162599819-162599841 GCAATGAGGGGCTTAGCACCTGG + Intergenic
964977756 3:162640191-162640213 GCAATGAGGGGCTTAGCACCTGG + Intergenic
964982506 3:162703164-162703186 GCAGTGAGGGGCTTAGCACCAGG - Intergenic
964983156 3:162710749-162710771 GCACTGAGGGGCTTAGCACCCGG - Intergenic
964993508 3:162844850-162844872 GCAGTTAGGGGTTTAGCACCCGG - Intergenic
965003525 3:162987478-162987500 GCAGTGAGGGGCTTAGCACCTGG + Intergenic
965040290 3:163499143-163499165 GCAATGAGCGGCTTAGCACCTGG + Intergenic
965044139 3:163552561-163552583 GCAATGAGGGGCTTAGCACCCGG - Intergenic
965092244 3:164179369-164179391 GCAGTGAGGGGCTTAGCACCTGG + Intergenic
965109428 3:164402129-164402151 GCACTGAGGGGCTTAGCACCCGG - Intergenic
965200347 3:165649556-165649578 GCAATGAGGGGCTTAGCACCCGG - Intergenic
965220906 3:165924577-165924599 GCAGTGAGGGGCTTAGCACCCGG - Intergenic
965245244 3:166258707-166258729 GCAATGAGGGGCTTAGCACCCGG - Intergenic
965256785 3:166424097-166424119 GCAGTGAGGGGCTTTGCACCTGG + Intergenic
965298127 3:166975955-166975977 GCAATGAGGGGCTTAGCACCCGG + Intergenic
965446472 3:168780260-168780282 GCAGTGAGGGATTTAGCACCTGG + Intergenic
965652355 3:170947344-170947366 GCATTGAGGGGCTTAGCACCCGG + Intergenic
965728574 3:171746006-171746028 GCAGTGAGGGGCTTAGCACCGGG + Intronic
965753237 3:171999110-171999132 GCAATGAGGGACTTAGCACCCGG - Intergenic
965943490 3:174212211-174212233 ACAGTGAGGGGCTTAGCACCCGG - Intronic
966076063 3:175937494-175937516 GAAGTGAGGGACTTGGCACCTGG + Intergenic
966108213 3:176362462-176362484 GCAGTGAGGGGCTTACCACCCGG - Intergenic
966183032 3:177204102-177204124 GCAGTGAGAGGTTTAGCACCCGG - Intergenic
966186164 3:177228843-177228865 GCAGTGAGGGGCTTAGCACTGGG - Intergenic
966191020 3:177271968-177271990 GCAGTGAGGGGCTTAGCATCCGG - Intergenic
966246074 3:177809137-177809159 GCAGTGAGGGGCTTAGCACCTGG - Intergenic
966372421 3:179263249-179263271 ACAGTGAGGGGCTTAGCACCTGG - Intronic
966548962 3:181183227-181183249 GCAGGGAGGGGCTTAGCACCTGG - Intergenic
966635770 3:182131783-182131805 ACAGTGAGAGGCTTTGTAGCTGG - Intergenic
966687836 3:182715414-182715436 GCAGTGAGGGGTTTTGTAGGAGG + Intergenic
966724999 3:183101018-183101040 GCAATGGGGGACTTAGCACCCGG + Intronic
966725439 3:183103985-183104007 GCAATGAGGGGCTTAGCACCCGG - Intronic
967234106 3:187367810-187367832 GCAGTGAAGTGCTTAGCACCTGG - Intergenic
967448501 3:189596245-189596267 GCAATGAGGGGCTTAGCACCCGG + Intergenic
967499158 3:190177288-190177310 GCAATGAGGGGCTTAGCACCCGG - Intergenic
967594921 3:191317237-191317259 GCAGTGAGGGGCTTAGCACCCGG - Intronic
967718345 3:192789153-192789175 GCCATGAGGGGCTTAGCACCCGG + Intergenic
968181601 3:196599276-196599298 GCAATGAGGGGCTTAGCACCCGG - Intergenic
968285962 3:197508925-197508947 GCAGTGAGGGTCTAGGTGCCTGG + Intergenic
968412804 4:404198-404220 GCAGTGAGGGGCTTAGCACCTGG - Intergenic
968469682 4:773687-773709 GCAGTGAGGGGCTTAGCACCTGG + Intergenic
968804431 4:2763321-2763343 GCAGTGAGGGGCTTAGCACCTGG - Intergenic
968998972 4:3964933-3964955 GCAGTGAGGGGCTTAGCACCTGG - Intergenic
969017708 4:4115521-4115543 GCAGTGAGGGGCTTAGCACCTGG + Intergenic
969303161 4:6309264-6309286 GCGGTGAGGGGCTTAGCACCCGG - Intergenic
969362352 4:6672845-6672867 GCAATGAGGGGCTTAGCACCCGG + Intergenic
969440738 4:7215250-7215272 GCAAGGAGGGACTTAGCACCCGG + Intronic
969493792 4:7514568-7514590 GCAGTGAGGGGCTTCCCACGGGG + Intronic
969654979 4:8491649-8491671 GCAGTGAGGGACTTGGCACCCGG - Intronic
969736281 4:8993090-8993112 GCTGTGAGAGGCTTAGCACCTGG - Intergenic
969755028 4:9143699-9143721 GCAGTGAGGGGCTTAGCACCTGG + Intergenic
969795481 4:9524654-9524676 GCAGTGAGGGGCTTAACACCTGG - Intergenic
969814930 4:9679983-9680005 GCAGTGAGGGGCTTAGCACCTGG + Intergenic
970038476 4:11768689-11768711 GCAGAGAGGGGCTTATTTCAGGG - Intergenic
970108316 4:12609752-12609774 GCAGTGAGGGGCTTAGCACCTGG + Intergenic
970272123 4:14358784-14358806 GCAGTGAGGGGCTTAGCACCTGG + Intergenic
970391212 4:15615035-15615057 GCAATGAGGGACTTAGCACCCGG + Intronic
970574581 4:17414526-17414548 GCAGTGAGGGGCTTAGCACCCGG - Intergenic
970576874 4:17436805-17436827 GCAGTGAGGGGCTTAGCACCCGG - Intergenic
970615761 4:17767046-17767068 GCAGTGAGGGGCTTAACACCCGG - Intronic
970649330 4:18159508-18159530 GCAATGAGGGAGTTAGCACCCGG - Intergenic
970673171 4:18418577-18418599 GCAATGAGGGGCTTAGCACCCGG - Intergenic
970692000 4:18630810-18630832 GCCGTGAGGGGCTTGGCACCTGG - Intergenic
970803524 4:20004133-20004155 GCAATGAGGGGCTTAGCACCCGG + Intergenic
970817894 4:20179272-20179294 GCAGTGAGGGGCTTAGCACCCGG - Intergenic
971030781 4:22634889-22634911 GCAGTGAAGGGCTCAGCACCCGG + Intergenic
971043356 4:22778834-22778856 GCAGTGAGGAGGTTAGCACCCGG - Intergenic
971209134 4:24599355-24599377 GCAGTGAGGGGCTAAGCACCTGG - Intergenic
971325954 4:25643908-25643930 GCAGAGAGGGGTTTAATTCCAGG + Intergenic
971377117 4:26064218-26064240 GCAATGAGGGGCTTAGTACCTGG - Intergenic
971563561 4:28112901-28112923 GCAATGAGGGGCTTAGCACCTGG + Intergenic
971564199 4:28117380-28117402 GCAGTGAGCGGCTTAGCACCCGG - Intergenic
971635104 4:29047641-29047663 GCAGTGAGGGGCTTAGCACCCGG + Intergenic
971639820 4:29117475-29117497 GCAATGAGGGGCTTAGCACCCGG + Intergenic
971709461 4:30092828-30092850 GCAGTGAGGGGCTTAGCATCCGG + Intergenic
971792358 4:31185205-31185227 GCAGTGAGGGGCTTAGCACCTGG - Intergenic
971811952 4:31438773-31438795 GCAATGGGGGACTTAGCACCCGG + Intergenic
971852092 4:31996510-31996532 GCAATGAGGGGCTTAGCAGCCGG + Intergenic
972022788 4:34335880-34335902 GCAATGAGGGACTTAGCACCCGG - Intergenic
972034793 4:34506817-34506839 GCAGTGAGGGGCTTAGCACCTGG - Intergenic
972173370 4:36375069-36375091 GCAGTGAGGGGCTTAGCACCCGG + Intergenic
972344635 4:38182685-38182707 GCAGTGAGGGGCTTAGCACCAGG + Intergenic
972360945 4:38325155-38325177 GTGGTGAGGGGCTTAGCACCTGG - Intergenic
972778609 4:42266061-42266083 GCAGTGAGGGGCTTAGCACTGGG + Intergenic
972900126 4:43672479-43672501 GCAATGGGGGACTTAGCACCGGG + Intergenic
972913298 4:43846290-43846312 GCAGTGAGGGGCTTAGCACCTGG + Intergenic
973037094 4:45420278-45420300 GCAATGAGGGGCTTACCATCTGG + Intergenic
973039943 4:45457354-45457376 GCAGTGAGGGGCTTAGCACCTGG - Intergenic
973045381 4:45530577-45530599 GCAGTGAGGGGCTTAGCACCTGG + Intergenic
973308076 4:48675462-48675484 GCAATGAGGGACTTAGCACCCGG + Intronic
973587765 4:52409985-52410007 GCAATGAGGGGCTTAGCATCCGG - Intergenic
973684356 4:53354324-53354346 GCAGTGAGGGGCTTAGCACCTGG - Intronic
973764311 4:54149539-54149561 TCAGTGAGGGGCTTAGCACCCGG - Intronic
973765096 4:54155363-54155385 GCAGTGAGGGGCTTAGCACCTGG - Intronic
973817577 4:54632658-54632680 GTAATGAGGGGCTTAGCACCCGG + Intergenic
973854112 4:54993634-54993656 GCAGTGAGGGGCTTAGCACCTGG + Intergenic
973878108 4:55241598-55241620 GCAGTGAGGGGCTTAGCCCCCGG + Intergenic
974128959 4:57730009-57730031 GCAATGAGGGGCTTAGCACCCGG - Intergenic
974147416 4:57965546-57965568 GCAATGAGGGACTCAGCACCCGG + Intergenic
974147703 4:57967316-57967338 GCAGCGAGGGGCTTAGCACCGGG + Intergenic
974188011 4:58465243-58465265 GCAGTGAGGGGCTTTGCAGCCGG + Intergenic
974207444 4:58724254-58724276 GCGCTGAGGGGCTTAGCACCGGG + Intergenic
974299254 4:60042457-60042479 GCAGTGAGGGGCTTAGCAACCGG - Intergenic
974484792 4:62492135-62492157 GCAATGAGGGACTTAGCACCCGG - Intergenic
974590600 4:63943113-63943135 GCAATGAGGGGCTTAGCACCCGG - Intergenic
974641747 4:64640712-64640734 GCAATGAGGGACTTAGCACCCGG - Intergenic
974781751 4:66561728-66561750 GCAATGAGGGGTTTAGCACCCGG - Intergenic
974792772 4:66712653-66712675 GCAATGAGGGGCTTAGCACCCGG - Intergenic
974804382 4:66860290-66860312 GCAGTGAGGGGCTTAGCACCCGG + Intergenic
974807565 4:66899698-66899720 GCAGTGAGGGGCTTAGTACCTGG - Intergenic
974827755 4:67152001-67152023 GCAATGAGGGGCTTAGCACCCGG + Intergenic
974839345 4:67283059-67283081 GCAGTGAGGGGCTCAGCACCTGG - Intergenic
974892298 4:67896801-67896823 GCAGTGAGGGGCTTAGCACCCGG - Intergenic
974992877 4:69115483-69115505 GAAGTGAGGGGCTTAGCACCCGG - Intronic
975028051 4:69576573-69576595 GCAGTGAGGGGCTTAGCACCGGG - Intergenic
975055400 4:69924012-69924034 GCAATGAGGGGCTTAGCACCCGG + Intergenic
975298819 4:72766020-72766042 GCAGTGAGGGGCTTAGCACCTGG + Intergenic
975439958 4:74399303-74399325 GCAATAGGGGGCTTAGCACCCGG - Intergenic
975596368 4:76050896-76050918 GCAATGAGGGGCTTAGCACCCGG - Intronic
975744952 4:77466506-77466528 GCAGTGAGGGGCTTAGCACCTGG + Intergenic
975754811 4:77561989-77562011 GCAGTGAGGAGCTTAGCACCTGG + Intronic
975755869 4:77570785-77570807 GCAGTGAGGGGCTTAGCACCCGG + Intronic
975898430 4:79122054-79122076 GCAATGAGGAGCTTAGCACCTGG + Intergenic
975994943 4:80302961-80302983 GCAGTGAGGGGCTTAGCACCTGG + Intronic
976406374 4:84664812-84664834 GCAATGAGGGGCTTAGCACCCGG + Intergenic
976520632 4:86021846-86021868 GCAGTGAGGGACTTAGCACCCGG - Intronic
976565535 4:86547418-86547440 GCAGTGAGGGGTTTAGCACCTGG + Intronic
976646872 4:87396185-87396207 GCAATGAGAGACTTAGCACCCGG - Intergenic
976736290 4:88313386-88313408 GCAGTGAGGGGCTTAGCACCTGG - Intergenic
976846075 4:89490178-89490200 GCAGTGAGGGGCTTAGCACCTGG + Intergenic
976980298 4:91218208-91218230 GCAATGGGGGACTTAGCACCCGG - Intronic
977206518 4:94169966-94169988 GCAGTGAGGGGCTTAGCACCCGG + Intergenic
977400070 4:96521235-96521257 GCAGTGAGGGGCTTAGCACCTGG + Intergenic
977606938 4:98993725-98993747 GCAGTGAGGGGCTTAGCACCTGG - Intergenic
977717351 4:100196759-100196781 GCAATGAGGGGCTTAGCACCCGG - Intergenic
977885768 4:102250527-102250549 GCAGTCAGGAGCTTAGCACCTGG - Intergenic
977906478 4:102483248-102483270 GCAATGAAGGACTTAGCACCCGG + Intergenic
978080248 4:104582103-104582125 GCAATGAGGGGCTTAGCACCCGG + Intergenic
978241889 4:106525584-106525606 GCAATGAGAGGGTTAGCACCCGG - Intergenic
978285524 4:107073216-107073238 GCAGTGAGGGGCTTAGCACCCGG + Intronic
978463616 4:108984590-108984612 GCAGTGAGGGGCTTAGCACCTGG - Intronic
978466251 4:109012598-109012620 GCAGTAAGGGGCTTAGCACCTGG + Intronic
978514606 4:109557525-109557547 GCAGTGAAGGGCTTAGCACCTGG + Intergenic
978748563 4:112222554-112222576 GCAGTGAGGGGCTTAGCACCAGG + Intergenic
978809083 4:112830928-112830950 GCAGTGAGGGGCTTAGCACCCGG + Intronic
978886541 4:113772442-113772464 GGCGTGAGGGGCTTAGCACCCGG + Intergenic
978917974 4:114148782-114148804 GCAGTGAGGGGCTTAGCACCTGG - Intergenic
978929804 4:114296391-114296413 GCAGTGAGGGGCTTAGCACCCGG - Intergenic
978999580 4:115200433-115200455 GCAATGAGGGGCTTAGCACCCGG - Intergenic
979033233 4:115678729-115678751 ACAGTGAGGGGCTTAGCACCGGG - Intergenic
979224187 4:118265679-118265701 GCATTGAGGGGCTTAGCACCTGG + Intergenic
979308316 4:119173907-119173929 GCAATGAGGGACTTAGCACTCGG + Intronic
979445672 4:120808806-120808828 GCAGTGAGGGACTTAGCACCTGG - Intronic
979678618 4:123435609-123435631 GCAGTGAGGGGCTTAGCACCTGG - Intergenic
979688585 4:123538038-123538060 GCAATGAGGGGCTTAGCACCCGG + Intergenic
979755870 4:124339174-124339196 GCAGTGAGGGGCTTAGCACCTGG + Intergenic
979822559 4:125192070-125192092 CCAGTGAGGGGCTTAACACCTGG + Intergenic
979825707 4:125229817-125229839 GCAATAAGCGGCTTAGCACCCGG - Intergenic
979857506 4:125651968-125651990 GCAGTGAGGGGCTTAGCACCTGG - Intergenic
979920456 4:126490131-126490153 GCAGTGAGGGGCTGAGCACCCGG + Intergenic
979949513 4:126874679-126874701 GCAGTGAGGGTCTTAGCACCCGG - Intergenic
980043383 4:127964476-127964498 GCAATGAGGGGCTTAGCACCCGG - Intronic
980051934 4:128047797-128047819 GCAGTGAGGGACTTGGCACCCGG - Intergenic
980115219 4:128672784-128672806 GCAGTGAGGGGCTTAGCACCTGG + Intergenic
980227976 4:130012902-130012924 GCAATGAGGGACTTAGCACCCGG + Intergenic
980230254 4:130038781-130038803 GCAATGAGGGGCTTAGCACCCGG - Intergenic
980384032 4:132063000-132063022 GCAGTGAGGGACTTAGCACAGGG - Intergenic
980628590 4:135406740-135406762 GCAATGAGGGACTTAGCACCCGG + Intergenic
980739264 4:136929134-136929156 GCAGTGAGGGACTTAGCACCAGG + Intergenic
980799756 4:137733857-137733879 GCAATAAGGGGCTTAGCATCCGG + Intergenic
980824103 4:138053138-138053160 GCAGTGAGGGGCTTAGCACCTGG - Intergenic
980827322 4:138088805-138088827 GCAGTGAGGGGCTTAGCAACTGG - Intergenic
981146727 4:141333257-141333279 GCAATGAGGGGCTTAGCACCCGG - Intergenic
981169566 4:141605634-141605656 GCAGTGAGGGGCTTAGCACCAGG - Intergenic
981176591 4:141690097-141690119 GCAATGAGGGACTTAGCACCGGG - Intronic
981275816 4:142897621-142897643 GCAATGAGGGACTTAGCACCCGG + Intergenic
982408222 4:155044424-155044446 GCAATGAGGGACTTAGCACCCGG + Intergenic
982647671 4:158044291-158044313 GCAGTGAGGGACTTAGCACCTGG + Intergenic
982679094 4:158408187-158408209 GCAATGAGGGGCTTAGCACCCGG + Intronic
982692776 4:158567062-158567084 GTAGTGAGGGGCTTAGCACCTGG + Intronic
982728188 4:158927823-158927845 GCAATGAGGGGCTTAGCACCCGG + Intronic
982758331 4:159251043-159251065 GCAGTGAGGGGCTTAGCACCTGG + Intronic
982770142 4:159390081-159390103 GCAGTGAGGGGCTTAGCACCCGG + Intergenic
982814583 4:159869272-159869294 GCAATGAGGGGCTTAGCACCTGG - Intergenic
982863378 4:160481881-160481903 GCAATGAGGGGCTTAGCACCTGG + Intergenic
982921268 4:161277372-161277394 GCAATGAGCGGCTTAGCACACGG + Intergenic
982985759 4:162203709-162203731 GCATTGAGGGTCTTGGCACCCGG + Intergenic
983060335 4:163152967-163152989 GCAGTGAGGGGCTTAGCACCCGG + Intronic
983064090 4:163189954-163189976 GCAATGAGGGGCTTAGCACCCGG - Intergenic
983134950 4:164068518-164068540 GCAGTGAGGGGCTTAGCACCTGG + Intronic
983230660 4:165126176-165126198 GCAATGAGGGGCTTAGCATTCGG - Intronic
983290674 4:165799637-165799659 GCAGTGAGGGGCTTAGCACCCGG - Intergenic
983425699 4:167581681-167581703 GCAGTGAGGGGCTTAGCACCTGG + Intergenic
983553059 4:169036074-169036096 GCAGTGAGGGGCTTAGCACCCGG - Intergenic
983656735 4:170091350-170091372 GTAGTGAGGGGCTTAGCACCCGG + Intronic
983734707 4:171043280-171043302 GCAGTGAGGGGCTTACCACCCGG + Intergenic
983752841 4:171298396-171298418 GAAATGAGGGGCTTAGCACCCGG + Intergenic
983834246 4:172369709-172369731 GCAGTGAGGGGCTTAGCACCTGG - Intronic
983835399 4:172377775-172377797 GCAGTGAGGGGCTTAGCACCTGG - Intronic
983843185 4:172482111-172482133 GCAGTGAGGGGCTTAGCACCCGG - Intronic
984069288 4:175092233-175092255 GCAGTGAGGGGCTTAGCACCAGG + Intergenic
984192841 4:176625404-176625426 GCAATGAGGGGCTTAGCACCCGG - Intergenic
984238823 4:177193435-177193457 GCAATGAGGGGCTTAGCACCCGG - Intergenic
984241831 4:177227767-177227789 GCAGTGAGGGGCTTAGTACCTGG - Intergenic
984265653 4:177495713-177495735 GCAATGAGGGGCTTAGCACCCGG + Intergenic
984770561 4:183433266-183433288 GCAGTGAGGGGCTTAGCACCCGG + Intergenic
984776115 4:183482931-183482953 GCAATGAGGGGCTTAGCACCCGG - Intergenic
984805348 4:183746680-183746702 GCAGTGAGGGGCTTAGCACCCGG - Intergenic
984901750 4:184592030-184592052 GCAGTGAGGGGCTTAGCACCTGG + Intergenic
984918098 4:184741328-184741350 GCAGTGAGGGGCTTAGCACCCGG + Intergenic
984948725 4:184990327-184990349 GCAATAAGGGACTTAGCACCCGG - Intergenic
985145425 4:186890235-186890257 GCAGTGAGGAGCTTACTACCCGG + Intergenic
985195176 4:187421183-187421205 GCAATGGGGGACTTAGCACCCGG - Intergenic
985203247 4:187505752-187505774 GCAATGAGGGGCTTAGCACCCGG + Intergenic
985269297 4:188179083-188179105 GCAGTGAGGGGCTTAGCACCCGG + Intergenic
985366398 4:189236429-189236451 GCAATGAGGGGCTTAGCACCCGG + Intergenic
985403604 4:189615456-189615478 GCAGTGAGGGGCTTAGCACCTGG - Intergenic
985403876 4:189616885-189616907 GCAATGAGGGGCTTAGCACCCGG - Intergenic
985507961 5:295340-295362 CCATTGAAGGGCTCAGTACCTGG + Intronic
985740074 5:1610328-1610350 CCATTGAAGGGCTCAGTACCTGG - Intergenic
986151998 5:5137907-5137929 GCAATGAGGGACTTAGCACCTGG + Intergenic
986626163 5:9725439-9725461 GCAATGAGGGGCTTAGCACCCGG + Intergenic
986697991 5:10375278-10375300 GCAGTGAGAGACTTGGCACCCGG + Intronic
986912389 5:12574183-12574205 GCAATGAGGGGCTTAGCACCCGG - Intergenic
986912536 5:12574713-12574735 GCAGTGAAGGGCTTAGCACCTGG - Intergenic
987084477 5:14456108-14456130 GCAGCGAGGGGCTTAGCACCTGG - Intronic
987146251 5:14994044-14994066 GCAATGAGGGGATTAGCACCCGG - Intergenic
987283728 5:16436304-16436326 GCAATGAGGGGCTTAGCACCGGG + Intergenic
987315293 5:16718073-16718095 GCAATGGGGGACTTAGCACCTGG + Intronic
987347431 5:16991177-16991199 GCAGTGAGGGGCTTAGCACCTGG - Intergenic
987352280 5:17032631-17032653 GAAGTGAGGGGCTTAGCACCTGG - Intergenic
987355850 5:17062351-17062373 GCAGAGAGGAGCTTAGCAACTGG + Intergenic
987358219 5:17083572-17083594 GCAATGAGGGGCTTAGCACCCGG + Intronic
987384014 5:17312011-17312033 GCAGTGAGGGACTTGGCACCCGG - Intergenic
987476699 5:18399911-18399933 GCAATGATGGGCTTAGCACCCGG - Intergenic
987488827 5:18551931-18551953 GCAGTGAGGGGCTTAGCACCTGG - Intergenic
987696595 5:21341518-21341540 GCAGTGAGAGGCTTAGCACCCGG + Intergenic
987876946 5:23691246-23691268 GCAATGAGGGACTTAGCACCCGG + Intergenic
988035582 5:25823557-25823579 GCAGTGAGGGGCTTAGCACCTGG - Intergenic
988073499 5:26324582-26324604 GCAATGAGGGGCTTAGCACCCGG + Intergenic
988132157 5:27120020-27120042 GCAATGAGGGACTTAACACCCGG + Intronic
988177262 5:27743583-27743605 GCAATGAGGGGCTTAGCACCCGG + Intergenic
988201778 5:28077892-28077914 GCAGTAAGGGGCTTAGCCCCTGG - Intergenic
988279558 5:29127861-29127883 GCAATGAGGGGCTTAGCACCCGG - Intergenic
988291754 5:29296684-29296706 GCAGTGAGGGGCTTAGCACCTGG - Intergenic
988489134 5:31692208-31692230 GCAGTGAGAAGCTTAGCACCTGG - Intronic
988755608 5:34245052-34245074 GCAGTGAGAGGCTTAGCACCCGG - Intergenic
988883586 5:35531748-35531770 GCAATGAGGGTCTTAGCACCCGG + Intergenic
988915898 5:35893106-35893128 GCAGTGGGGGACTTAGCACCCGG - Intergenic
989003201 5:36782702-36782724 GCAATGAGGGGCTTAGCACCGGG + Intergenic
989165903 5:38433432-38433454 GCAGTGAGGGGTTTTGTGTCTGG - Intronic
989346793 5:40438781-40438803 GCAATGAGGGACTTAGCACCCGG + Intergenic
989559677 5:42836490-42836512 GCAGTGAGGGGCTTAGCACCTGG + Intronic
989777376 5:45225733-45225755 GGAGTGAGGCGCTTAGCACCCGG + Intergenic
989956843 5:50369560-50369582 GCATTGAGGGGCTTAGCACCCGG + Intergenic
989965825 5:50465136-50465158 GCAATGAGGGACTTAGCACCTGG + Intergenic
990243255 5:53837092-53837114 GCAGTGAGGGGCTTAGCACCTGG + Intergenic
990323180 5:54649259-54649281 GCACTGAGGGGCTTAGCACCCGG - Intergenic
990345261 5:54865198-54865220 GCAATGAGGGGCTTAGCACCCGG + Intergenic
990418964 5:55613473-55613495 GCAGGGAGGGGTTTAGCACCTGG + Intergenic
990461521 5:56035611-56035633 GCAATGAGGGACTTAGCACCCGG + Intergenic
990490065 5:56295446-56295468 GCAATGAGGGGCTTAGCACCCGG + Intergenic
990512154 5:56498896-56498918 GCAGTGAGGGGCTTAGCACCTGG - Intergenic
990869478 5:60415576-60415598 GCAGTGAGGGGCTTAGCACCTGG + Intronic
990880224 5:60530441-60530463 GAAGTGAGGGGTTTAGCACCTGG + Intergenic
991330227 5:65485670-65485692 GCAGTGAGGGGCTTAGCACCTGG - Intergenic
991427093 5:66503401-66503423 ACAGTGAGGGGGTTAGCACCTGG + Intergenic
991505420 5:67318984-67319006 CCAGTGAGGGGCTTAGCACCGGG + Intergenic
991567568 5:68020641-68020663 GCAATGAGGGGCTTAGCACCCGG - Intergenic
991657792 5:68920989-68921011 GCAGTGAGGGGCTTAGCACCCGG + Intergenic
991743852 5:69710794-69710816 GCAGTGAGAGGCTTAGCACCCGG - Intergenic
991753861 5:69844448-69844470 GCAGTGAGAGGCTTAGCACCCGG + Intergenic
991795424 5:70290526-70290548 GCAGTGAGAGGCTTAGCACCCGG - Intergenic
991803486 5:70401203-70401225 GCAGTGAGAGGCTTAGCACCCGG + Intergenic
991823219 5:70586062-70586084 GCAGTGAGAGGCTTAGCACCCGG - Intergenic
991833173 5:70719561-70719583 GCAGTGAGAGGCTTAGCACCCGG + Intergenic
991887791 5:71290045-71290067 GCAGTGAGAGGCTTAGCACCCGG - Intergenic
992048859 5:72925613-72925635 GCAGTGAGGGGCTTAGTACCCGG + Intergenic
992050359 5:72935360-72935382 GCAGTGAGGGGCTTAGCACCCGG + Intergenic
992947443 5:81823844-81823866 GCAGTGAGAGACTTAGCACCCGG + Intergenic
993031868 5:82714811-82714833 GCAGTGAGGGGCTTAGCACCCGG + Intergenic
993202220 5:84830552-84830574 GCAGTGAAGGGCTTAGCACCCGG - Intergenic
993328582 5:86569762-86569784 GCAAAGAGGGGCTTAGCACCCGG - Intergenic
993770285 5:91917398-91917420 GCAATGAGGGGCTTAGCACCCGG + Intergenic
993803548 5:92375129-92375151 GCAGTGAGGGGCTTAGCACCTGG - Intergenic
994096338 5:95851289-95851311 GCAATGAGGGGCTTAGCACCCGG + Intergenic
994167007 5:96618624-96618646 GCAGTGAGGGGCTTAGCACCTGG + Intronic
994210777 5:97085463-97085485 GCAGTGAGGGGCTTAGCACCCGG - Intergenic
994239866 5:97407286-97407308 ACAGTGAGGGGCTCAGCACCCGG + Intergenic
994254795 5:97580233-97580255 GCAATGAGGGACTTAGCACCCGG - Intergenic
994507106 5:100656884-100656906 GCAATGAGGGGCTTAGCACCCGG + Intergenic
994509844 5:100689106-100689128 GCAATGAGGGACTTAGCACCCGG - Intergenic
994605604 5:101962684-101962706 GCAATGAGGGACTTAGCACCCGG - Intergenic
994620339 5:102155060-102155082 GCAGTGAGGGGCTTAGCACCCGG + Intergenic
994647754 5:102491586-102491608 GCAGTGAGGGGCTTAGCACCTGG - Intronic
994669750 5:102752187-102752209 GCAGTGAGGGGCTTAGCACCCGG + Intergenic
994701704 5:103142273-103142295 ACAATGAGGGACTTAGCACCCGG - Intronic
994841389 5:104929125-104929147 GCAATGAGGGCCTTAGCACCCGG + Intergenic
994928819 5:106154428-106154450 GCAGTGAGGGGCTTAGCACCTGG + Intergenic
994932437 5:106206295-106206317 GCTGGGAGGGGCTTAGCACCTGG - Intergenic
994935288 5:106246375-106246397 GCAGTGAGAGGCTTAGCACCTGG + Intergenic
995112374 5:108442278-108442300 GCAGTGAAGGGCTTAGCACCTGG - Intergenic
995206662 5:109488083-109488105 GCAGTGAGGGGCTTAGCACCCGG - Intergenic
995326408 5:110894222-110894244 GCAGTGAGCAGCTTAGCACCTGG - Intergenic
995388347 5:111612404-111612426 GCAGTGAGGGGCTTAGCACTGGG - Intergenic
995529130 5:113075157-113075179 GCAGTGAGGGGCTTAGCACCCGG + Intronic
995568673 5:113457266-113457288 GCAATGAGGGACTTAGCACCCGG + Intronic
995582629 5:113617436-113617458 ACAGTGAGGGGTTTAGCACCCGG + Intergenic
995656505 5:114432802-114432824 GCAATGAGGGGCTTAGCACCTGG + Intronic
995679872 5:114704527-114704549 GCAATGAGGGACTTAGCACCCGG - Intergenic
995700358 5:114928958-114928980 GCAGTGAGGGGCTTAGCACTGGG + Intergenic
995920396 5:117304783-117304805 GCAATGGGGGACTTAGCACCCGG + Intergenic
995988442 5:118208200-118208222 GCAGTGAGGGGCTTAGCACCCGG - Intergenic
996298560 5:121954178-121954200 GCAGCGAAGGGCTTAGCACCCGG - Intergenic
996435689 5:123430669-123430691 GCAATGAGGGGCTTAGCACCCGG + Intergenic
996567198 5:124892538-124892560 GCAGTGAGGGGCTTAGCACCCGG + Intergenic
996575899 5:124976353-124976375 GCAGTGAGGGGCTTAGCACCCGG - Intergenic
996747097 5:126854767-126854789 GCAGTGAGGGGCTTAGCACCTGG - Intergenic
996815577 5:127569577-127569599 GCGGTGAGGGGCTTAGCACCTGG + Intergenic
997352215 5:133239107-133239129 GCAGTGAGGGGCTTAGCACCTGG + Intronic
997375499 5:133394475-133394497 ACAGCGAGGGGCTTAGCACCCGG + Intronic
997760558 5:136444335-136444357 GCAATGAGGGGCTTAGCACCCGG + Intergenic
999348548 5:150845585-150845607 GCAGTGAGGGGCTTAGCACCTGG + Intergenic
999406179 5:151309314-151309336 GCAATGAGGGGCTTAGCACCCGG + Intergenic
999809576 5:155114953-155114975 GCAGTGAGGGGCTTAGCACCTGG + Intergenic
1000084736 5:157879403-157879425 GCAGTGAGGTCCTTAGCACCCGG + Intergenic
1000207998 5:159080586-159080608 GCAGTGTGGGGCTAAGTACTTGG - Intronic
1000212362 5:159119294-159119316 GCAGTGAGGGGCTTAGCACCTGG + Intergenic
1000329193 5:160194135-160194157 GCAATGAGGGACTTAGCACCTGG - Intronic
1000432357 5:161166346-161166368 GCAGTGAAGGGCTTAGCACCTGG - Intergenic
1000547609 5:162621965-162621987 GTAGTGAGGGGCTTAGCACCTGG + Intergenic
1000609145 5:163355979-163356001 GCAGTGAGGGGCTTAGCACCTGG + Intergenic
1000847911 5:166304504-166304526 GCAAAGAGGGGGTTAGTTCCAGG + Intergenic
1000889318 5:166784737-166784759 GCAGTGAGGGGCTTAGCACCTGG - Intergenic
1000891822 5:166810434-166810456 GCAATGAAGAGCTTAGCACCTGG - Intergenic
1000902489 5:166927186-166927208 GCAGTGAGGGGCTTAGCACCCGG - Intergenic
1001841542 5:174880790-174880812 GCAGTGAGGGGCTTAGCACCCGG + Intergenic
1001843558 5:174901640-174901662 GCAGTGAGGGGCTTAGCACCCGG + Intergenic
1002221740 5:177688357-177688379 GCAATGAGGGACTTAGCACCCGG + Intergenic
1002556548 5:180046182-180046204 TCAGTGAGGGGCTTAGCACCTGG - Intronic
1002612780 5:180432288-180432310 GTGGTGAGGGGCTTAGCACCTGG + Intergenic
1002616446 5:180459291-180459313 GCAGTGAGGGGCTTAGCACCCGG + Intergenic
1002758018 6:179715-179737 ACAGTGAGGGGCTTAGCACCCGG + Intergenic
1002789379 6:426439-426461 GCAATGAGGGGCTTAGCACCCGG - Intergenic
1002790731 6:435777-435799 GCAGTGACGGGCTTAGCACCTGG - Intergenic
1002793204 6:450103-450125 GCAGTGAGGGGCTTACCACACGG + Intergenic
1002817707 6:694747-694769 GCAGTGAGGGGCTTAGCACCTGG + Intergenic
1002907026 6:1457209-1457231 GCAATGAGGGGCTTAGCACCTGG - Intergenic
1003060721 6:2860262-2860284 GCAATGGGGGACTTAGCACCCGG + Intergenic
1003061912 6:2870318-2870340 CCAGTAAGGGGCTTCGTACCCGG - Intergenic
1003070220 6:2939752-2939774 GCAATGAGGGGTTTAGCACCCGG + Intergenic
1003100189 6:3170888-3170910 GCAATGAGGGGCTTAGCACCAGG + Intergenic
1003170850 6:3721003-3721025 GCAATGAGGGACTTAGCACCCGG - Intergenic
1003176871 6:3758284-3758306 GCACTGAGGGGCTTAGCACCTGG + Intergenic
1003177286 6:3761520-3761542 GAAGTGAAGGGCTTAGCACCTGG + Intergenic
1003178483 6:3771758-3771780 GCAGTGAGGGGCTTAGCACCTGG + Intergenic
1003213749 6:4090263-4090285 GCAGTGAGGAGCTTAGCACCTGG + Intronic
1003284851 6:4725536-4725558 GCAGTGAGAGGCCTAGCACCTGG - Intronic
1003489224 6:6606668-6606690 GTAGTGAGGGGCTTAGCACCTGG - Intronic
1003490030 6:6613487-6613509 GCAGTGAGGAGCTTAGCACCTGG - Intronic
1003506677 6:6745914-6745936 GCACTGAGCGGCTTAGTGCCTGG - Intergenic
1003508843 6:6762719-6762741 ACAGTGAGGAGCTTAGCACCTGG - Intergenic
1003531372 6:6940214-6940236 GCAATGAGAGGCTTAGTACCCGG + Intergenic
1003532856 6:6952459-6952481 GCAGTGAGGGACTTAGCACCCGG + Intergenic
1003578040 6:7315340-7315362 GCAGTGAGGGGCTTAGAACCTGG + Intronic
1003578296 6:7316982-7317004 GCAGTGAAGGGCTTAGCACCTGG - Intronic
1003581442 6:7344338-7344360 GCAATGAGGGGTTTAGCACCCGG + Intronic
1003591615 6:7441370-7441392 GCAGTGAGGAACTTAGCACTTGG + Intergenic
1003593717 6:7456482-7456504 GCAGTGAGGGGCTTAGCACCTGG + Intergenic
1003671537 6:8164455-8164477 GCAATGAGGGGCTTAGCACCCGG + Intergenic
1003717697 6:8666091-8666113 GCAATGGGGGACTTAGCACCTGG + Intergenic
1003736893 6:8887288-8887310 GCAATGAGGGACTTAGCACTCGG + Intergenic
1003748005 6:9024388-9024410 GCAGTGAGGGGATTAGCACCCGG + Intergenic
1003770159 6:9290678-9290700 GCAATGAGGGGCTTAGCACCCGG - Intergenic
1003836209 6:10074905-10074927 GCAGTCAGGGGCTTAGCACCTGG - Intronic
1003845725 6:10171846-10171868 GCAATGAGGAACTTAGCACCCGG + Intronic
1003862788 6:10337533-10337555 GCAATGAGGGACTTAGCACCCGG + Intergenic
1003947278 6:11087339-11087361 GCAATGAAGGACTTAGCACCCGG + Intergenic
1003956675 6:11171187-11171209 GCAATGAGGGGCTCAGCACCCGG + Intergenic
1003983979 6:11417231-11417253 GCAGTGAGGGACTTAGCACCTGG - Intergenic
1004036965 6:11933203-11933225 GCATTGAGGGGCTTAGCACCTGG + Intergenic
1004196587 6:13511273-13511295 GCAGTGAGGGGTTTAGCACCTGG - Intergenic
1004200262 6:13541663-13541685 GCAATGAGGTGCTTAGCACCCGG + Intergenic
1004220613 6:13743326-13743348 GGTGTGAGGGGCTTAGCACTCGG + Intergenic
1004224393 6:13772611-13772633 GCAATGAGGGGCTTAGCACCCGG + Intergenic
1004248456 6:14002549-14002571 GCAGTGAGGAGCTTAGCACCTGG + Intergenic
1004250318 6:14018156-14018178 GAAGTGAGGGGCTTAGCACCTGG + Intergenic
1004338215 6:14783803-14783825 GTAGTGAGGGGCTTAGCACCTGG - Intergenic
1004354068 6:14916105-14916127 GCAGTGAGGGGCTTAGCACCCGG + Intergenic
1004452390 6:15758996-15759018 GCAGTGAACGGCTTAGCACCGGG - Intergenic
1004503209 6:16227136-16227158 GCAATGAGGGGCTTAGCACCTGG - Intergenic
1004511642 6:16288376-16288398 GCAATGAGAGGCTTAGCACCCGG + Intronic
1004519313 6:16347003-16347025 GCAGTGAGGGGCTTAGCAGTTGG + Intronic
1004607374 6:17206676-17206698 GCAGTGAGGGGCTTAGCACCCGG - Intergenic
1004647944 6:17580868-17580890 GCAGTGAGGGGCTTAGCACCTGG + Intergenic
1004689095 6:17976426-17976448 GCAATGAAGGGCTTAGCACCCGG - Intronic
1004693310 6:18011428-18011450 GCAGTGAGGAACTTAGCACCTGG - Intergenic
1004861379 6:19807206-19807228 GCAGTGAGGGGCTTAGCACCTGG - Intergenic
1004866056 6:19854665-19854687 GCAATGAGGGGCTTAGCACCCGG - Intergenic
1004883695 6:20032449-20032471 GCAGTAAGGGGCTTAGCACCCGG + Intergenic
1004906215 6:20239185-20239207 GCAGTGAGGGGTTTAGCACCTGG + Intergenic
1004906937 6:20245009-20245031 GCAATGAGGGACTTAGCACCCGG - Intergenic
1004908521 6:20259692-20259714 GCAGTGAGGAGCTTAGCACCTGG + Intergenic
1004912629 6:20301374-20301396 GCAATGAGGGGCTTAGCACCCGG + Intergenic
1004914446 6:20319040-20319062 GCAGTGAGGGGCTTAGCACCTGG + Intergenic
1004914617 6:20320279-20320301 GCAGCAAGGGGCTTAGCACCTGG + Intergenic
1005042263 6:21610099-21610121 GCAGTGAGGGGCTTAGCACCTGG - Intergenic
1005059282 6:21761280-21761302 GCAATGAGGGACTTAGCACCCGG + Intergenic
1005114285 6:22318653-22318675 GCAATGAGGGGCTTAGCACCTGG - Intergenic
1005332882 6:24766174-24766196 GCAATGGGGGACTTAGCACCCGG - Intergenic
1005561443 6:27045407-27045429 GCAGTGAGGGGCTTAGCACCTGG + Intergenic
1005596214 6:27381306-27381328 GCAATGAGGGGCTTAGCACCCGG - Intronic
1005600873 6:27425066-27425088 GCAATGAGGGGCTTGGCACCTGG - Intergenic
1005707447 6:28469591-28469613 ACAATGAGGGACTTAGCACCCGG - Intergenic
1005725057 6:28639980-28640002 GCAGTGAGGGGCTTAGCACCCGG - Intergenic
1005749932 6:28872831-28872853 GCAATGGGGGACTTAGCACCCGG - Intergenic
1005758896 6:28950031-28950053 GCAATAAGGGACTTAGCACCCGG - Intergenic
1005766314 6:29015216-29015238 GCAGTGAGGGGTTTAGCACCCGG + Intergenic
1005977007 6:30807680-30807702 GCAATGAGGGACTTAGCACCCGG - Intergenic
1005978241 6:30816536-30816558 GCAGTGAGGGGCTTAGCACCCGG - Intergenic
1006005769 6:31000587-31000609 GCAATGAAGGGCTTAGCACCCGG + Intergenic
1006007822 6:31016923-31016945 GCAGTGAGGAACTTAGCACCCGG + Intronic
1006008301 6:31020842-31020864 GCAGTGAGGGGCTTAGCACCCGG + Intronic
1006033634 6:31195583-31195605 GCAATGAGGGACTTAGCACCCGG + Intergenic
1006127966 6:31852182-31852204 GCAGTGAGGGGTTTAGCACCTGG + Intergenic
1006173201 6:32107270-32107292 GCAGAGAGGGTCTTTGCACCAGG + Intronic
1006227067 6:32548162-32548184 GCAATGGGGGACTTAGCACCTGG - Intergenic
1006351106 6:33521746-33521768 GCAGCGAGGGGTTTAGCACCCGG - Intergenic
1006352638 6:33532512-33532534 GCAATGAGGGACTTAGCACCCGG + Intergenic
1006477830 6:34269148-34269170 GCAATGGGGGACTTAGCACCCGG + Intergenic
1006748903 6:36364470-36364492 GCAATGAGGGACTTAGCACCCGG - Intronic
1006850610 6:37095418-37095440 GCAGAGAGTGGATTAATACCAGG + Intergenic
1007738736 6:43998221-43998243 GCAGTGAGGGGCTTAGCACCTGG + Intergenic
1007789083 6:44298607-44298629 GCAGTGAGGGGCCAGGCACCCGG + Intronic
1008005595 6:46406005-46406027 GCAGTGAGGGACTTAGCACCCGG - Intronic
1008038781 6:46774721-46774743 GCAATGAGGGACTTAGCACCCGG + Intergenic
1008230815 6:48983630-48983652 GCAGTGAGGGGCTTAGCACCTGG - Intergenic
1008230898 6:48984066-48984088 GCAGTGAGGGGCTTAGCACCTGG + Intergenic
1008284347 6:49629787-49629809 GCAATGAGGGACTTAGCACCAGG - Intronic
1008567835 6:52786637-52786659 GCAGTGAGGGGCTTAGCATCTGG + Intergenic
1008844831 6:55950432-55950454 GCAGTGAGGGTCTTAGAACCTGG + Intergenic
1008971102 6:57369117-57369139 TCAGTGAGGGACTCAGTACAGGG + Intronic
1009160063 6:60270936-60270958 TCAGTGAGGGACTCAGTACAGGG + Intergenic
1009402689 6:63275178-63275200 GTAGTGAGGGGCTTAGCACCTGG - Intergenic
1009418835 6:63443183-63443205 GCAATGAGGGGCTTAGCATCCGG - Intergenic
1009470281 6:64023899-64023921 GCACCGAGGGGCTTAGCACCTGG + Intronic
1009471417 6:64031279-64031301 GCAGTGAGGGGCTTAGCACCTGG + Intronic
1009510799 6:64547919-64547941 GCAGTGAGGGGCTTAGCACCTGG - Intronic
1009587648 6:65627664-65627686 GCAATGAGGGACTTAGCACCCGG + Intronic
1009615496 6:65999604-65999626 GCGGCGAGGGGATTAGCACCCGG - Intergenic
1009664322 6:66655604-66655626 GCATTGAGGGGCTTAGCACCTGG - Intergenic
1009685335 6:66949337-66949359 GCAATAAGGGGCTTAGCACCCGG + Intergenic
1009746678 6:67825522-67825544 GCAGTGAGGGGCTTAGCACCCGG + Intergenic
1009800721 6:68533554-68533576 GCAGTGAGGAGCTTAGCACCTGG + Intergenic
1009872263 6:69467324-69467346 GCACTGAGGGGCTTAGCACCTGG + Intergenic
1010066292 6:71686277-71686299 GCAGTGAGGGGCTTAGCACCTGG + Intergenic
1010199315 6:73269112-73269134 GCAATGAGGGGCTTAGCACCCGG - Intronic
1010235651 6:73572774-73572796 GCAATGAGGGGCTTAGCACCCGG - Intergenic
1010277946 6:73990865-73990887 GCAGTAAGGGGCTTAGCACCTGG - Intergenic
1010617383 6:78029925-78029947 GCAGTGAGGGGCTTAGCACCCGG + Intergenic
1011143690 6:84189490-84189512 GCAATGGGGGACTTAGCACCCGG + Intronic
1011178127 6:84587553-84587575 GCAGTGAGGGGCTTAGCATCTGG + Intergenic
1011246518 6:85326091-85326113 GCAGTGAGGGGCCTAGCACCCGG + Intergenic
1011338348 6:86285014-86285036 GCAGTGAGGGGCTTAGCATCTGG - Intergenic
1011620090 6:89234684-89234706 GCAGTGAGGGGCTTAGCACCTGG - Intergenic
1011974763 6:93282765-93282787 GCAGTGAGGGGCTTAGCACCTGG + Intronic
1012131287 6:95497065-95497087 GCAATGAGGGGCTTAGCACCCGG + Intergenic
1012578219 6:100829427-100829449 GCAATGAGGGGCTTAGCACCTGG - Intronic
1012733535 6:102910881-102910903 GCAGTGAGGGGCTTAGCACCTGG - Intergenic
1013025722 6:106269644-106269666 GCAATGAGGGGCTTAGCACCCGG - Intronic
1013080224 6:106805878-106805900 GCAGTGAGGCGCTTAGCACCCGG + Intergenic
1013081487 6:106817000-106817022 GCAATGGGGGACTTAGCACCCGG - Intergenic
1013143569 6:107364483-107364505 GCAATGGGGGACTTAGCACCCGG - Intronic
1013410782 6:109881381-109881403 GCAATGAGGGACTTAGCACCCGG - Intergenic
1013694800 6:112689561-112689583 GCAGTGAGGGGCGTAGCACCTGG - Intergenic
1013774943 6:113669297-113669319 GCAATGCAGGGCTTAGTAGCAGG + Intergenic
1013853335 6:114541913-114541935 GGAATGAGGGGCTTAGCACCCGG - Intergenic
1013957241 6:115855317-115855339 GCTGTGAGGGGCTTAGCACCTGG + Intergenic
1013960092 6:115889223-115889245 GCAGTGAGGGGTTTAGCACCTGG + Intergenic
1013963440 6:115928277-115928299 GCAGTGAGGGGCTTAGCACCTGG - Intergenic
1014055884 6:117014877-117014899 GCAATTAGGGGCTTAGCACCCGG + Intergenic
1014240740 6:119015446-119015468 GCAGTGAGGGGCTTAGCACCCGG + Intronic
1014280806 6:119441122-119441144 GCAATGAGGAGCTTAGTACCTGG + Intergenic
1014507758 6:122280703-122280725 GCAATGAGGGGCTTAGCACCCGG + Intergenic
1014586295 6:123202073-123202095 GCAATGAGGGGCTTAGCACCTGG + Intergenic
1014718560 6:124892095-124892117 GCAATGAGGGACTTAGCACCCGG + Intergenic
1014738997 6:125125979-125126001 GCAATGAGGGCTTTAGCACCCGG + Intronic
1014788467 6:125644574-125644596 GCAATGAGGGGCTTAGCACCCGG + Intergenic
1014921075 6:127214828-127214850 GCAATGAGGGGCTTAGCACCTGG - Intergenic
1016104733 6:140148360-140148382 GCAGTGAGGGGCTCAGCACCTGG - Intergenic
1016172934 6:141041810-141041832 GCAGTGAGGGGCTTAGCACCTGG - Intergenic
1016217195 6:141618334-141618356 GCAATGAGGGGCTTAGCACCTGG + Intergenic
1016482321 6:144495387-144495409 GCAATGAGGGACTTAGCACCGGG - Intronic
1016859055 6:148698818-148698840 GCAGTGAGGGGCTTACCACCTGG - Intergenic
1017298981 6:152834466-152834488 GCAATGAGGGACTTAGCACCCGG + Intergenic
1017325085 6:153133744-153133766 GCAATGAGGGGTTTAGCACCCGG + Intergenic
1017383523 6:153857178-153857200 GCAGTGAGGGGCTTAGCGCCTGG - Intergenic
1017537368 6:155363191-155363213 GCAATGAGGGACTTAGCACCCGG + Intergenic
1017581223 6:155866993-155867015 GCAATGAGGGGCTTAGCAACCGG - Intergenic
1017839511 6:158210026-158210048 GCAATGAGGGGCTTAGCACCCGG - Intergenic
1018064241 6:160114740-160114762 GCAATGAGGGGCTTAGCACCCGG - Intergenic
1018109409 6:160520505-160520527 GCAGTGAGGGGCTTAGCACCCGG - Intergenic
1018545669 6:164933420-164933442 TCAATGAGGGACTTAGCACCCGG + Intergenic
1018551343 6:165001865-165001887 GCAGTGAGGGGCTTAGTACCAGG - Intergenic
1018624649 6:165765524-165765546 GCAATGAGGGACTTAGCACCCGG - Intronic
1019000267 6:168744023-168744045 GCAATGAGGGACTTAGCACCCGG - Intergenic
1019086224 6:169480158-169480180 GCAGTGAGGGGCTTAGCACCTGG + Intronic
1019610727 7:1935461-1935483 GCAGGTAGGGGCTTAGTGGCTGG - Intronic
1019618355 7:1977354-1977376 GCAGTGAGGGGCTTAGCACCTGG - Intronic
1019758587 7:2791545-2791567 ACAGGGAGGCGCCTAGTACCTGG + Intronic
1019944272 7:4314176-4314198 GCAGTGAGGGACTTAGTACCCGG - Intergenic
1019965756 7:4497168-4497190 GCAGTGAGGGACTTAGCACCCGG - Intergenic
1020008283 7:4793649-4793671 GCAGTGAGGGGCTTAGCACCTGG + Intronic
1020163935 7:5793706-5793728 ACAGTGAGGGGCTTAGCACCCGG + Intergenic
1020552270 7:9621677-9621699 GCAGTGAGGGGCTTAGCACCTGG - Intergenic
1020662204 7:10995790-10995812 GCAGTGAGGGGCTTAGCACCTGG - Intronic
1020784440 7:12556397-12556419 GCAGTGAGGGGCTTAGCACCCGG - Intergenic
1021065764 7:16170819-16170841 GCAATGAGGGGCTTAGCACCTGG - Intronic
1021324121 7:19245606-19245628 GCAATGAGGGACTTAGCACCGGG + Intergenic
1021359413 7:19692487-19692509 GCAGTGAGGGGCTTAGCACCTGG - Intergenic
1021513811 7:21461475-21461497 GCAGTGAGGGGCTTAACACCTGG - Intronic
1021520706 7:21536786-21536808 GCAGTGAGAGGCTTAGCACCTGG - Intergenic
1021567391 7:22028805-22028827 GAAGTGAGGGGCTTAGCACCTGG + Intergenic
1021567883 7:22032562-22032584 GCAGTGAGGGGCTTAGCACCTGG - Intergenic
1021686770 7:23193971-23193993 GCAATGAGAAGCTTAGCACCCGG - Intronic
1021761276 7:23904949-23904971 GCAGTGAGGGGCTTAGCACCTGG - Intergenic
1022174140 7:27857251-27857273 GCAGTGAGGGGCTTGGCACCTGG - Intronic
1022852088 7:34274145-34274167 ACAGTAAGGGGGTTAATACCAGG + Intergenic
1023127933 7:36973860-36973882 GCAATGAGGGGCTTAGCACCCGG + Intronic
1023377987 7:39577522-39577544 GGAGGGAGGGGTTTAGCACCCGG + Intronic
1024269075 7:47628599-47628621 GCAATGAGGGACTTAGCACCCGG + Intergenic
1024335640 7:48203151-48203173 GCAATGAGGGACTTAGCACCCGG - Intronic
1024443853 7:49453813-49453835 GCAGTGAGGGGCTTAGCACCTGG + Intergenic
1024465901 7:49711375-49711397 GCAATGAGGGGCTTAGCAACCGG + Intergenic
1024691275 7:51805957-51805979 GCAATGAGGGGTGTAGCACCTGG + Intergenic
1024735829 7:52303153-52303175 GAAGTGATGGGCTTAGCACCTGG - Intergenic
1024741779 7:52362772-52362794 GCAGTGAGGGGCTTAGCACCTGG + Intergenic
1024748210 7:52431479-52431501 GCAGTGAGGGGCTTAGCACCTGG - Intergenic
1024794342 7:53004054-53004076 GCAGTGAGGGGCTTAGCACCTGG + Intergenic
1024825426 7:53385399-53385421 GCAATGAGGGACTTAGCACCAGG - Intergenic
1024834043 7:53495143-53495165 GCAATGAGGGGCTTAGCACCCGG + Intergenic
1025077779 7:55957895-55957917 GCAGTGAGGGACTGAATAACAGG + Intronic
1026098347 7:67364762-67364784 GCAGTGAGGGGCTTAGCACCTGG - Intergenic
1026177921 7:68014101-68014123 GCAGTGATGGGATTTGCACCTGG + Intergenic
1026187092 7:68090652-68090674 GCAATGGGGGACTTAGCACCCGG - Intergenic
1026202944 7:68231153-68231175 GCAGTGAGGGACTTGGCACCCGG + Intergenic
1026335893 7:69393949-69393971 GCAATGAGGGGCTTAGCACCCGG + Intergenic
1026512338 7:71037716-71037738 GCAATGAGGGGCTTAGCACCCGG + Intergenic
1026516561 7:71078111-71078133 GCAGTGAGGGGCTTAGCACCCGG + Intergenic
1026596561 7:71738317-71738339 GCAATGAGGGACTTAGCACCCGG - Intergenic
1027238009 7:76309675-76309697 GCAGTGAGGGGCTTAGCACCTGG - Intergenic
1027277440 7:76573087-76573109 GCAGTTAGGGGCCAAGTGCCAGG - Intergenic
1027561666 7:79739422-79739444 GCAATGAGGGGCTTAGCACCCGG + Intergenic
1027564042 7:79768202-79768224 GCAATGAGGGGCTTAGCACCCGG - Intergenic
1027579717 7:79977841-79977863 GCAGTGAGGGGCTTAGCACCCGG - Intergenic
1027665888 7:81042830-81042852 GCAATGAGGGACTTAGCACCCGG + Intergenic
1027667536 7:81057721-81057743 GCAATGAGGGACTTAGCACCTGG - Intergenic
1027668745 7:81071232-81071254 GCAGTGAGGGGCTTAGCATCCGG + Intergenic
1027674467 7:81141860-81141882 GCAATGAGGGGCTTAGCACCCGG + Intergenic
1027698290 7:81437327-81437349 GCAGTGAGGGGCTTAGCCCCCGG - Intergenic
1027778959 7:82499734-82499756 GCAGTGAGGGGCTTAGCACCTGG + Intergenic
1027868095 7:83673440-83673462 GCAATGAGGGACTTAGCACCCGG + Intergenic
1027956048 7:84880696-84880718 GCAGTGAGGGGCTTAGCACCTGG + Intergenic
1028070096 7:86440689-86440711 GCAATGAGGGGCTTAGCTCCGGG + Intergenic
1028303294 7:89228966-89228988 GCAGTGAGGGGCCTAGCACCTGG - Intronic
1028511224 7:91627631-91627653 GCAATGAGGGGCTTAGCACCCGG - Intergenic
1028558035 7:92143565-92143587 ACAGTGAGGGGCTTAGCACCTGG - Intronic
1028719422 7:94012106-94012128 GGAGTGAGGGGCTTAGTAACTGG - Intergenic
1028778321 7:94705615-94705637 GCAATGAGGGGCTTAGCACCCGG + Intergenic
1029037914 7:97541332-97541354 GCAGTGAGGGACTTATCACCCGG + Intergenic
1029065349 7:97843104-97843126 GCAGTGAAGGGCTTAGCACCCGG - Intergenic
1029076150 7:97936050-97936072 GCAGTGAGGGGCTTAGCACCTGG + Intergenic
1029407087 7:100381841-100381863 GCAGTGAGGGACTTAGCACCTGG + Intronic
1029567506 7:101348697-101348719 GCAATGAGGGACTTAGCACCCGG + Intergenic
1029809623 7:103034441-103034463 GCAGTGAGGGGCTTAGCACCTGG - Intronic
1029832377 7:103275163-103275185 GCAATGGGGGACTTAGCACCTGG - Intergenic
1029903967 7:104071921-104071943 GCAGTGAGGGGCTTAGCACCTGG + Intergenic
1029988160 7:104940276-104940298 GCAATGAGGGGCTTAGCACCCGG + Intergenic
1030102125 7:105956004-105956026 GCAGTGAGCGGCTTAGCACCTGG - Intronic
1030215720 7:107042556-107042578 GCAGTCAGGGGCTTAGCACCTGG - Intergenic
1030367013 7:108657454-108657476 GCAATGAGGGGCTTAGCACCTGG - Intergenic
1030599985 7:111582181-111582203 GCAATGAGGGACTTAGCACCCGG - Intergenic
1030733477 7:113017465-113017487 GCAATGAGGGGCTTAGCACCCGG + Intergenic
1030780410 7:113593441-113593463 GCCGTGAGGGACTTAGCACCCGG + Intergenic
1030980688 7:116182185-116182207 GCAGTGAGGGACTTAGCACCTGG - Intergenic
1031109972 7:117596267-117596289 GCAGTGAGGGGCTTAGCACCTGG + Intronic
1031253141 7:119413591-119413613 GCAGTGAGGGGCTTATCACCCGG - Intergenic
1031378795 7:121060091-121060113 GCAATGAGGGGCTTAGCACCCGG + Intronic
1031513313 7:122674067-122674089 GAAGTAAGGGGTTTAGCACCTGG - Intronic
1031902861 7:127429292-127429314 GCAGTGAGGGGCTTAGCACCCGG + Intronic
1032248068 7:130230144-130230166 GCAATGAGAGACTTAGCACCTGG + Intergenic
1032561607 7:132898845-132898867 GCAATGAGGGGCTTAGCACCTGG - Intronic
1033065085 7:138146286-138146308 GCAGTGAGGGGCTTAGCACCTGG + Intergenic
1033312423 7:140271543-140271565 GCAGTGAGGGGCTTAGCACCTGG - Intergenic
1033758610 7:144418164-144418186 GCAGTGAGGGGCTTAGCACCTGG - Intergenic
1033866637 7:145697607-145697629 GCAGTGAGGGGCTTAGCACCTGG - Intergenic
1034091039 7:148363930-148363952 GCAATGGGGGACTTAGCACCCGG + Intronic
1034097909 7:148426530-148426552 GCAATGAGGGGCTTAGCACCCGG + Intergenic
1034155014 7:148949203-148949225 GCAATGGGGGACTTAGCACCCGG + Intergenic
1034167762 7:149038936-149038958 GCAATGAGGGACTTAGCACCCGG - Intergenic
1034656045 7:152730514-152730536 GCAATGAGGGGCTTAGCACCCGG - Intergenic
1034900837 7:154907028-154907050 GCAGTGAGGGGCTTAGCACCCGG + Intergenic
1034967111 7:155398387-155398409 GCAGTGAGGGGCTTAGCACCTGG - Intergenic
1035463904 7:159063378-159063400 GCAGTGAGGGGCTTAGCACCCGG - Intronic
1035683579 8:1507394-1507416 GCAGTGAAGGGCTCAGCACCTGG - Intronic
1035833913 8:2727956-2727978 GCAGTGAAGGGCTTGGCACCTGG + Intergenic
1035999238 8:4582949-4582971 GCAATGAGGGACATAGCACCCGG + Intronic
1036123820 8:6045256-6045278 GCGGTGAGGGACTTAGCACCTGG - Intergenic
1036135059 8:6152829-6152851 GCAGTGAGGGGCTTAGCACCTGG + Intergenic
1036260472 8:7235818-7235840 GCCGTGAGGGGCTTAGCACCTGG + Intergenic
1036306142 8:7603704-7603726 GCTGTGAGGGGCTTAGCACCTGG - Intergenic
1036312509 8:7694374-7694396 GCCGTGAGGGGCTTAGCACCTGG + Intergenic
1036356988 8:8051689-8051711 GCTGTGAGGGGCTTAGCACCTGG - Intergenic
1036378265 8:8219015-8219037 GCAGTGAGGGGCTTAGCACCTGG + Intergenic
1036441035 8:8781630-8781652 GCAATGAGGGGCTTAGCACCCGG - Intergenic
1036554651 8:9847994-9848016 GCAGTGAGGGGCTTAGCACCTGG - Intergenic
1036801369 8:11794924-11794946 GCAGTGAGGGGCTTAGCACCTGG + Intergenic
1036831360 8:12022770-12022792 ACAGTGAGGGGCTTAGCACCTGG + Intergenic
1036851306 8:12203602-12203624 GCAGTGAGGGGCTTAGCACCTGG - Intergenic
1036872670 8:12445876-12445898 GCAGTGAGGGGCTTAGCACCTGG - Intergenic
1036901583 8:12673573-12673595 GCAGTGAGGGGCTTAGCACCTGG + Intergenic
1036914975 8:12796417-12796439 GCAATGAGGGGCCTAGCACCTGG + Intergenic
1036925515 8:12901349-12901371 TCTGTGAGGGGATTAGTTCCAGG - Intergenic
1036928654 8:12931543-12931565 GCAGTGAGGGGCTTAGCACCCGG - Intergenic
1037065017 8:14566961-14566983 GCAGTGAAGGGCTTAGCACCCGG + Intronic
1037241548 8:16784028-16784050 GCAATGGGGGACTTAGCACCCGG + Intergenic
1037263847 8:17037056-17037078 GCAGTGAGGGACTTAGCACCCGG - Intronic
1037417580 8:18667922-18667944 GCAGTGAGGGGCTTAGTAACTGG - Intronic
1037425613 8:18751281-18751303 TCAGTGAGGGGCTTAGCACCCGG - Intronic
1037440803 8:18913889-18913911 GCTGAGATGGGCTTGGTACCTGG - Intronic
1037622630 8:20578196-20578218 GCAGTGCGGGGCTTAGTGGATGG + Intergenic
1037810971 8:22086676-22086698 GCAATGAGGGGCTTAGCACCCGG + Intergenic
1037957557 8:23071024-23071046 GCAATGAGGGGTTTAGCACCCGG - Intergenic
1037983521 8:23272238-23272260 GCAATGAGGGACTTAGCACCTGG + Intronic
1038174068 8:25164618-25164640 GCAATGGGGGACTTAGCACCCGG + Intergenic
1038847599 8:31244345-31244367 GCAGTGAGGGGCTTAGCACCTGG - Intergenic
1038870698 8:31489988-31490010 GGAATGAGGAGCTTAGCACCCGG + Intergenic
1039069117 8:33634071-33634093 GCAATGAGGGGCTTAGCACCCGG - Intergenic
1039587613 8:38719962-38719984 GCAGTGAGGGGCTTAGCACCTGG + Intergenic
1039637296 8:39180236-39180258 GCAGTGAGGGGCTTAGCACCTGG + Intronic
1040000874 8:42575338-42575360 GCAGTGAGGGGCTTAGCACCTGG + Intergenic
1040003703 8:42600305-42600327 GCAGTGACGGGCTTAGCACCTGG - Intergenic
1040014452 8:42689615-42689637 GCAGTGAGGGGCTTAGCACCTGG + Intergenic
1040027688 8:42796725-42796747 GCACTGAGCTGCTTAGCACCCGG + Intergenic
1040323958 8:46331854-46331876 GCAGTGAGGGGCTTAGCACCTGG + Intergenic
1040583415 8:48716216-48716238 GCAGTGAGGGGCTTAGCACCCGG - Intronic
1040622239 8:49103249-49103271 GCAGTGAGGGGCTTAGCACCCGG - Intergenic
1040791018 8:51230769-51230791 GCAGTGAGGGGCTTAGCACCTGG + Intergenic
1040804336 8:51377638-51377660 GCAGTGAGGGGCTTAGCACCTGG + Intronic
1040806839 8:51405045-51405067 GCAGTGAGGGGCTTAGCACCCGG - Intronic
1040868049 8:52070514-52070536 GCAGTGACGAGTTTAGAACCAGG + Intergenic
1040952708 8:52953095-52953117 GCAATGAGGGACTTAGCACATGG - Intergenic
1040952884 8:52953935-52953957 GCAGTGATGGGCTTAACACCTGG + Intergenic
1040964590 8:53071376-53071398 GCAGTGAGGGGCTTAGCAACCGG - Intergenic
1040965576 8:53077866-53077888 GCAGTGAGGGGCTTAGTGCCTGG - Intergenic
1041034663 8:53776137-53776159 GCAATGACGGACTTAGCACCCGG - Intronic
1041461687 8:58118551-58118573 GCAGGGTGGGGCGTGGTACCTGG + Intronic
1041604345 8:59762194-59762216 GTAATGAGGGGCTTAGCACCTGG - Intergenic
1041623547 8:59999986-60000008 GCAGTGAGGGGCTTAGCACCTGG + Intergenic
1041636682 8:60153197-60153219 GCAGTGAGGGGCTTAGCACCTGG - Intergenic
1041738986 8:61139159-61139181 GCAGTGAGGGGCTCATCGCCTGG + Intronic
1041914524 8:63126231-63126253 GCAATGAGGGGATTAGCACCCGG + Intergenic
1042169489 8:65978030-65978052 TCAGTGAGGGGCTTAGCACCTGG - Intergenic
1042336021 8:67630845-67630867 GCAGTGAGAGGCTTACCACCTGG + Intronic
1042512569 8:69626710-69626732 GCAGTGAGGGGCTTAGCACCCGG - Intronic
1042948763 8:74179768-74179790 GCAGTGAGGGGCTTATCACCCGG - Intergenic
1043102225 8:76060646-76060668 GCAGCGAGGAGCTTAGCACCTGG - Intergenic
1043129941 8:76447852-76447874 GCAATGAGGGACTTAGCACCCGG - Intergenic
1043346459 8:79303616-79303638 GCAATGAGGGGCTTAGCACCCGG + Intergenic
1043435320 8:80231930-80231952 GCAGTGAGGGGCTTAGCACCCGG + Intergenic
1043621035 8:82192489-82192511 GGAGTTAGAGGCTTAGCACCCGG - Intergenic
1043640165 8:82441541-82441563 GTAGTGAGGGGCTAAGCACCTGG + Intergenic
1043670636 8:82880810-82880832 GCAGTGAGGGGCTTAGCACCTGG + Intergenic
1043701122 8:83290474-83290496 GCAATGAGGGACTTAGCACCCGG + Intergenic
1043709877 8:83403064-83403086 GCAGTGGGGGACTTAGCACCCGG + Intergenic
1043731941 8:83694193-83694215 GCAGTGAGGGGCTTAGCACCTGG - Intergenic
1043857162 8:85276184-85276206 GCAGTTAGGGGCTTAGCACCTGG + Intronic
1044075816 8:87820956-87820978 GCAATGAGGGACTTAGCACCCGG + Intergenic
1044088491 8:87971280-87971302 GCAGTGAGAGGCTTAGCACCTGG + Intergenic
1044404893 8:91816485-91816507 GCAGTGAGGGGCTTAGCACCTGG + Intergenic
1044441642 8:92230897-92230919 GCAGTGAGGGGCTTAGCACCCGG + Intergenic
1044505005 8:93006856-93006878 GCTGCTAGGGGCTTAGTCCCAGG - Intronic
1044633479 8:94300572-94300594 GCAATGAGGGACTTAGCACCTGG - Intergenic
1044853576 8:96452449-96452471 GCAGTGAGGGGCTTAGCACCTGG + Intergenic
1044862152 8:96534048-96534070 GCAGTGAGGGGCTTAACACCCGG - Intronic
1044963912 8:97557036-97557058 GCAGTAAGGGGCTTAGCACCCGG + Intergenic
1045096211 8:98800709-98800731 GCAGTGAAGGGCTTAGCACCCGG + Intronic
1045232331 8:100317013-100317035 GCAATGAGGGACTTAGCACCCGG - Intronic
1045306029 8:100957349-100957371 GCAGTGAGTGGCTTAGCACCTGG - Intergenic
1045407391 8:101880237-101880259 GCAGTAAGGGGCTTAGCACCAGG - Intronic
1045467767 8:102485751-102485773 GCAATGAGGGACTTAGCACCCGG - Intergenic
1045652102 8:104350942-104350964 GGAGTGAGGGGTTTAGAACAGGG - Intronic
1045678415 8:104633123-104633145 GCAGTGAGGGGCTTAGCACCCGG - Intronic
1045743338 8:105387525-105387547 GCAGTGAGGGGCTTAGCACCTGG - Intronic
1046149353 8:110202809-110202831 GCAATGAGGGGCTTAGCACCTGG - Intergenic
1046260326 8:111758994-111759016 GCAGTGAGGGGCTTAGCACCTGG - Intergenic
1046265398 8:111823529-111823551 GCAATGAGGGACTTAGTACCCGG - Intergenic
1046288900 8:112132813-112132835 GCAATGAGGGGCTTAGCACCCGG + Intergenic
1046445333 8:114311472-114311494 GAAATGAGGGGCTTAGCACCTGG + Intergenic
1046521399 8:115330807-115330829 GCAGTGAGGGGCTTCGCACCCGG - Intergenic
1046621216 8:116531209-116531231 GCAGTGAGGGGCTTAGCACCTGG + Intergenic
1046661203 8:116949984-116950006 GCAGTGAGGGGCTTAGCACCCGG - Intergenic
1047100183 8:121667656-121667678 GCAGTGAGAGGCTTAGCACCTGG - Intergenic
1047124732 8:121948159-121948181 GCAGTGAAGAGCTTAGCACCCGG + Intergenic
1047631709 8:126714875-126714897 GCAATGAGGGGCTTAGCACCCGG - Intergenic
1048112849 8:131487152-131487174 GCAGTGAGGGGTTTAGCACCCGG + Intergenic
1048186887 8:132249895-132249917 GCAGTGAGGGGCTTAGTACCTGG - Intronic
1048576029 8:135690652-135690674 GCAGTGAGGGGCTTAGCACCTGG - Intergenic
1048655411 8:136530649-136530671 GCAGTGAGGGGCTTAGCACCTGG - Intergenic
1048676969 8:136794039-136794061 GCAATGAGGGACTTAGCACCCGG - Intergenic
1048757504 8:137755359-137755381 GCAATGAGGGGCTTAGCACCCGG - Intergenic
1048789170 8:138084257-138084279 GCAATGAGGGGCTTAGCACCCGG + Intergenic
1049087643 8:140490753-140490775 GCAATGAGGGACTTAGCACCCGG - Intergenic
1049157705 8:141076809-141076831 GCAGTGAGGGGCTTAGCACCTGG + Intergenic
1049500308 8:142959598-142959620 GCAGTGAGGGACTTGGCACCCGG + Intergenic
1049674072 8:143882109-143882131 GCAGAGAGGGCCTGGGTACCTGG - Intergenic
1049857934 8:144875291-144875313 GCAGTGAGGGGCTTAGCACCTGG + Intergenic
1050127495 9:2374097-2374119 CCAGTGCTAGGCTTAGTACCTGG + Intergenic
1050249952 9:3733932-3733954 GCAGTGAGGGGCTTAGCACCTGG + Intergenic
1050294907 9:4195419-4195441 ACAGTGAGGGGCTTAGCACCCGG + Intronic
1050920609 9:11196987-11197009 GCAATGAGGGACTTAGCACCAGG + Intergenic
1050975253 9:11929094-11929116 GCAGTGAGGGACTTAGTACCTGG - Intergenic
1051305094 9:15700280-15700302 GCAATGAGGGGCTTAGCACCCGG - Intronic
1051383298 9:16480629-16480651 GCAATGAGGGGTTTAGCACCCGG + Intronic
1051419712 9:16877293-16877315 ACAGTGAGGGGCTTAGCACCTGG - Intergenic
1051425101 9:16924661-16924683 GCAGTGAGGGGCTTAGCACCTGG - Intergenic
1051439852 9:17072726-17072748 GCAATGAGGGGTTTAGCACCCGG + Intergenic
1051449404 9:17178624-17178646 GCAGTGAGGGGCTTAGCACCTGG - Intronic
1051463794 9:17354056-17354078 GCAATGAGGGACTTAGCACCCGG + Intronic
1051549782 9:18315582-18315604 GCAGTGAGGGACTTAGCACCTGG - Intergenic
1051892690 9:21959372-21959394 GGAATGAGGGACTTAGCACCCGG + Intronic
1052056669 9:23914653-23914675 GCAGTGAGGGACTTAGCACCTGG - Intergenic
1052075441 9:24135190-24135212 GCAACTAGGGGCTTAGCACCCGG + Intergenic
1052122788 9:24738658-24738680 GTAGTGAGGGGCTTAGCACCCGG + Intergenic
1052313433 9:27092775-27092797 GCAGTGAGGGGCTTAGCACCTGG + Intergenic
1052576569 9:30299389-30299411 GTAGTGAGGGGCTTAGCACCTGG + Intergenic
1052979542 9:34438046-34438068 GCAATGAGGGGCTTAGCACCCGG + Intronic
1052985352 9:34483003-34483025 GCAATGGGGGACTTAGCACCCGG - Intronic
1053475246 9:38377697-38377719 GCAGTGAGGGGCTTAGCACCTGG + Intergenic
1053547920 9:39042596-39042618 GCAATGAGGGACTTAGCACCCGG - Intergenic
1054722444 9:68617145-68617167 GCAATGAGGGGCTCAGCACCCGG + Intergenic
1055102568 9:72480440-72480462 GCAGTGAGGGGCTTAGCACCTGG - Intergenic
1055248598 9:74276170-74276192 GCAGTGAGGGGCTTGGCACCCGG - Intergenic
1055461455 9:76523930-76523952 GCAGTAAGGGGTTTAGCACCTGG - Intergenic
1055651371 9:78410118-78410140 GCAGTGAGGGGCTTAGCACCTGG + Intergenic
1055654931 9:78442196-78442218 GCAGTGAGAGGCTTAGCACCTGG + Intergenic
1055925616 9:81507495-81507517 GCAGTGAGGGGCTTAGCACCCGG + Intergenic
1056080968 9:83093536-83093558 GCAATGAGGGGCTTAGCACCCGG - Intergenic
1056216269 9:84408599-84408621 GCAGTGAGGGGCTTAGCACCTGG + Intergenic
1056305759 9:85289167-85289189 GCAGTGAGGGGCTTAGCACCCGG + Intergenic
1056735938 9:89209523-89209545 GCAATGAGGGGCTTAACACCTGG + Intergenic
1056743743 9:89282547-89282569 GCAATGAGGGGCTTAGCACCCGG + Intergenic
1056771400 9:89480657-89480679 GCAATGGGGGACTTAGCACCCGG - Intronic
1056791439 9:89627763-89627785 GGTGTGAGGGGCCAAGTACCAGG + Intergenic
1056914019 9:90729593-90729615 GCAGTGAGGGGCTTAGCACCCGG + Intergenic
1057300704 9:93880062-93880084 GCAGTGAGGGGCTTAGCACCTGG + Intergenic
1057383926 9:94591383-94591405 GCAATGGGGGACTTAGCACCCGG - Intronic
1057543866 9:96001958-96001980 GCAATGGGGGACTTAGCACCCGG - Intronic
1057628644 9:96701150-96701172 GCAATGGGGGACTTAGCACCTGG - Intergenic
1057726915 9:97574340-97574362 GCAGTGAGGGGCTTAGCACCTGG + Intronic
1057781731 9:98056076-98056098 GCAGAGATGGGACTAGTACCCGG - Intergenic
1058174874 9:101724354-101724376 GCAATGAGGGGCTTAGCACCCGG - Intronic
1058235689 9:102487179-102487201 GCAGTGAGGGACTTAGCACCTGG - Intergenic
1058365179 9:104200716-104200738 GCAGTTAGGGACTTAGCACCTGG + Intergenic
1058379574 9:104363139-104363161 GCAGTGAGGGGCTTAGCATCTGG - Intergenic
1058585371 9:106501535-106501557 GCAGTGAGGGGCTTAACACCTGG - Intergenic
1058786491 9:108393635-108393657 GCAATGAGGGACTTAGCACCCGG + Intergenic
1059791154 9:117642967-117642989 GCAGTGAGGGGCTTAGCACCTGG - Intergenic
1059810615 9:117852147-117852169 GCAATGAGGGGCTTAGCACCCGG + Intergenic
1059891446 9:118809455-118809477 GGAGTGAGGGGCTTAGCACATGG - Intergenic
1060091353 9:120746509-120746531 GCAGTGAGGGGCTTAGCACCTGG + Intergenic
1060305375 9:122406392-122406414 GCAGTGAGGGGCTTAGCACCTGG - Intergenic
1060695319 9:125704654-125704676 TCAGTGAGGGCTTGAGTACCAGG - Intronic
1061483821 9:130910243-130910265 GCAATGAGGAACTTAGCACCTGG + Intronic
1061807346 9:133143930-133143952 GCAGTGTGGGGCTGAGGAGCAGG - Intronic
1061926293 9:133807635-133807657 GCGGTGAGGGGCTGAGACCCAGG + Intronic
1062146218 9:134991271-134991293 GCAATGAGGGACTTAGCACCCGG - Intergenic
1062457083 9:136644947-136644969 TCAGGGAGGGGCTCAGCACCTGG - Intergenic
1203460429 Un_GL000220v1:31225-31247 GCAGTGAGGGGCTTAGCACCTGG - Intergenic
1203662377 Un_KI270753v1:57454-57476 AGAGTGAGGGGCTTGGCACCTGG + Intergenic
1203662879 Un_KI270753v1:61610-61632 GCAGTCAGGGGCTTAGCACCTGG - Intergenic
1186152601 X:6690746-6690768 GCAGTGAGGGGCTTAGCGCCCGG - Intergenic
1186282083 X:8003514-8003536 GCAGCGAGGGGCTTAGCACCTGG - Intergenic
1186293186 X:8121709-8121731 GCAGTGAGGGGCTTAGCACCTGG + Intergenic
1186295645 X:8145169-8145191 GCAGTGAGGGGCTTAACACCTGG - Intergenic
1186323259 X:8452730-8452752 GCAATGAGGGACTTAGCACCCGG - Intergenic
1187005848 X:15231970-15231992 GCAATGAGGGGCTTAGCACCCGG - Intergenic
1187139042 X:16575574-16575596 GCAATGAGGGGCTTAGCACCCGG + Intergenic
1187304602 X:18083924-18083946 GCAATGGGGGACTTAGCACCCGG + Intergenic
1187904008 X:24049813-24049835 GCAATGAGGGACTTAGCACCCGG + Intergenic
1188112007 X:26204924-26204946 GCAGTGAGGGGTTTAGCACCTGG + Intergenic
1188189523 X:27157125-27157147 GCAGTGAGGGACTTGGCACCCGG + Intergenic
1188242298 X:27807980-27808002 GCAGTGAGGCGATTGGTATCTGG + Exonic
1188242392 X:27808488-27808510 GCAGTGAGGCGGTTGGTATCTGG + Intronic
1188242560 X:27809258-27809280 GCAGTGAGGGGCTTAGCACCTGG + Intronic
1188881811 X:35499398-35499420 GCAGTGAGGGGCTTAGCACCTGG + Intergenic
1189209834 X:39275738-39275760 GCAGTGAGGGGCTTAGCACCTGG + Intergenic
1189467123 X:41285948-41285970 GCAGTGAGGGGCTTAGCACCCGG - Intergenic
1189896842 X:45665017-45665039 GCAGTGAGGGGCTTAGCACCTGG - Intergenic
1190030233 X:46965316-46965338 GCAGAGAGAGACTTAGGACCAGG + Intronic
1190045876 X:47111243-47111265 GCAATGAGGGGCTTAGCACCCGG - Intergenic
1190413973 X:50163570-50163592 GCAATGAGGGACTTAGCACCCGG - Intergenic
1191053908 X:56222791-56222813 GCAGTGAGGGGCTTAGCACCTGG - Intergenic
1191105080 X:56767613-56767635 GCAGTGAGGGGCTTAGCAACTGG + Intergenic
1191618642 X:63192811-63192833 CCAATGAGGGGCTTAGTACCTGG - Intergenic
1192186760 X:68952278-68952300 GCAGTGAGGGGCTTAGCACCTGG + Intergenic
1192244485 X:69361324-69361346 GCAGTGATGGGCATGGTAGCTGG + Intergenic
1192251397 X:69416888-69416910 GCAGTGAGGGGCTGAGCACCTGG + Intergenic
1192869665 X:75173837-75173859 GCAATGAGGGACTTAGCACCCGG - Intergenic
1192870572 X:75179757-75179779 GCAATGAGGGACTTAGCACCCGG - Intergenic
1193271063 X:79530701-79530723 GCAGTGAGGGGCTTAGCACCCGG + Intergenic
1193538165 X:82738443-82738465 GCAATGAGGGACTTAGCACCCGG - Intergenic
1193719977 X:84975000-84975022 GCTGTGAGGGGCTTAGCACCTGG + Intergenic
1193804049 X:85972597-85972619 GCAGTGAGGGGCTTAGCACCCGG - Intronic
1194025590 X:88746567-88746589 GCAGTGAGGGGCTTAGCACCTGG - Intergenic
1194173488 X:90617996-90618018 GCAGTGAGGGGCTTAGCACCCGG - Intergenic
1194204458 X:90995527-90995549 GCAGTGAGGGGCTTAGCACCCGG + Intergenic
1194340461 X:92699720-92699742 GCAGTGAGGGGCTTAGCACCCGG - Intergenic
1194384377 X:93235852-93235874 GCAGTGAGGGGCTTAACACCTGG + Intergenic
1194650829 X:96512491-96512513 GCAATGGGGGACTTAGCACCCGG - Intergenic
1195256309 X:103094234-103094256 GCAATGAGGGGCTTAGCACCTGG + Intergenic
1195259365 X:103117307-103117329 ACAGTGAGGGGCTTAGCACCTGG - Intergenic
1195460265 X:105115949-105115971 GCAGTGAGGGGCTTAGCACCTGG - Intronic
1195896376 X:109749560-109749582 GCAATGAGGGGCTTAGCACCCGG - Intergenic
1195909606 X:109876090-109876112 GCAGTGAGGGGCTTAGCACCTGG - Intergenic
1196197922 X:112855095-112855117 GCAGTGAGGGGCTTAGCACCTGG - Intergenic
1196319539 X:114270800-114270822 TCAATGAGGGGCTTAGCACCCGG - Intergenic
1196582687 X:117394802-117394824 GCAATGAGGGACTTAGCACCCGG + Intergenic
1196608264 X:117680860-117680882 GCATTGAGTGGCTTAGTAAATGG - Intergenic
1196662535 X:118282981-118283003 GCAATGGGGGACTTAGCACCTGG - Intergenic
1196714607 X:118799077-118799099 GCAATGGGGGACTTAGCACCCGG + Intergenic
1196741513 X:119029635-119029657 GCAATGAGGGACTTAGCACCTGG + Intergenic
1196761980 X:119208712-119208734 GCAATGAGGGACTTAGGACCCGG - Intergenic
1196762354 X:119211119-119211141 GCAATGAGAGACTTAGCACCCGG - Intergenic
1196775195 X:119331995-119332017 GCAATGAGGGACTTAGGACCCGG + Intergenic
1196775501 X:119333716-119333738 GCAATGAGGGGCTTAGCACCTGG + Intergenic
1196781473 X:119387824-119387846 GCAATGAGAGACTTAGCACCCGG - Intergenic
1196793987 X:119488103-119488125 GGAATGAGGGACTTAGCACCCGG - Intergenic
1196845054 X:119890712-119890734 GCAATGAGGGGTTTAGCACCCGG + Intergenic
1196860870 X:120026025-120026047 GCAGTGACGGGCTTAGCACCCGG - Intergenic
1197000296 X:121431768-121431790 GCAATGAGGGGCTTAGCACTCGG - Intergenic
1197331189 X:125155715-125155737 GCAATGAAGGGCTTAGCACCTGG - Intergenic
1197376809 X:125690820-125690842 GCAATGAGGAGCTTAGCACCCGG - Intergenic
1197533778 X:127663210-127663232 GCAGTGAGGGGCTTAGCACCTGG - Intergenic
1197607920 X:128606725-128606747 ACAGTGAGGGGCTTAGCACCCGG + Intergenic
1197978751 X:132194207-132194229 GCAGTGAGGGGCTTAGTACCTGG + Intergenic
1198060911 X:133044498-133044520 GCAGTGAGGGGCTTAGCACCTGG + Intronic
1198299978 X:135325575-135325597 GCAATGAGGGACGTAGCACCCGG + Intronic
1198468108 X:136921530-136921552 GCAGTGAGGGGCTTAGCACCTGG + Intergenic
1198664319 X:139004265-139004287 GCAATGAGGGACTTATCACCCGG - Intronic
1198694441 X:139320923-139320945 GCAATGAGGGGCTTAGCACCTGG + Intergenic
1198972599 X:142298485-142298507 GCAATGAGGTGCTTAGCACCCGG - Intergenic
1199009950 X:142745963-142745985 GCAATGAGGGACTTAGCACCCGG - Intergenic
1199028806 X:142972376-142972398 GCAATGAGGGACTTAGCACCCGG - Intergenic
1199050235 X:143228930-143228952 GCAATGAGGGACTTAGCACCTGG - Intergenic
1199094851 X:143726473-143726495 GCAGTGAGGGGTGTAGTACCTGG - Intergenic
1199134170 X:144231449-144231471 GCAGTGAGGGGCTTAGCACCTGG - Intergenic
1199175531 X:144783753-144783775 GCAATGAGGGACTTAGCACCCGG + Intergenic
1199285098 X:146046396-146046418 GCAGTGAGGGGCTTAGCATCTGG - Intergenic
1199356255 X:146867122-146867144 GCAGTGAGGGGCTTAGCACCCGG - Intergenic
1199628112 X:149758689-149758711 GCAGTGAGGGGCTTAGCACCTGG + Intergenic
1199831292 X:151551427-151551449 GCAATGAGGGACTTAGCACCCGG - Intergenic
1199831790 X:151555391-151555413 GCAGTGAGGAGCTTAGCACCTGG - Intergenic
1199833031 X:151563020-151563042 GCAGTGAAGGGCTTAGCACCTGG - Intergenic
1199975872 X:152894598-152894620 GCAGAGCTGGGCTTAGAACCTGG - Intergenic
1200423571 Y:2998615-2998637 GCAGTGGGGAACTTAGCACCCGG - Intergenic
1200512606 Y:4099237-4099259 GCAGTGGGGAACTTAGCACCCGG + Intergenic
1200519709 Y:4195688-4195710 GCAGTGAGGGGCTTAGCACCCGG - Intergenic
1200550298 Y:4570968-4570990 GCATTGAGGGGCTTAGCACCCGG + Intergenic
1200648820 Y:5816456-5816478 GCAGTGAGGGGCTTAGCACCCGG - Intergenic
1200725842 Y:6666998-6667020 GCAATGGGGGACTTAGCACCTGG - Intergenic
1200829082 Y:7673251-7673273 GCAGTGAGGGGCTTACCACCTGG + Intergenic
1200873635 Y:8128756-8128778 GCAGTAAGGGGCTTAGCACCAGG - Intergenic
1200888672 Y:8298738-8298760 GCAATGAGAGACTTAGCACCGGG + Intergenic
1200955314 Y:8938454-8938476 GCAGTGAGGGGTGTAGCACCTGG + Intergenic
1201232648 Y:11879789-11879811 GAAGTGAGGTGCTTAGCACCTGG - Intergenic
1201260946 Y:12158607-12158629 GCAGTGAGGGGCTTAGCACCTGG - Intergenic
1201285489 Y:12375249-12375271 GCAGTGAGGGGCTTAGCACCCGG - Intergenic
1201423050 Y:13820445-13820467 GCAATGAGGGACTTAGCACCCGG - Intergenic
1201430515 Y:13897358-13897380 GCAGTGAGGGGCTTAGCACCTGG + Intergenic
1201468338 Y:14309407-14309429 GCAGTAAGGGGCTTAGCACCTGG + Intergenic
1201469109 Y:14314611-14314633 GCAGTGAGGGGCTTAGCACCTGG + Intergenic
1201487066 Y:14505771-14505793 GCAGTGAGGGACTTAGCACTCGG + Intergenic
1201499586 Y:14627533-14627555 GCAGAAAGGGGCTTAGCACTCGG - Intronic
1201555284 Y:15260284-15260306 GCAGTGAGGGGCTTAGCACTGGG + Intergenic
1201556320 Y:15267419-15267441 CCAGTGAGGGGCTTAGCACTGGG + Intergenic
1201573026 Y:15433965-15433987 GCAGTGAGGGGCTTAGCACCTGG + Intergenic
1201715795 Y:17043227-17043249 GCAATAAGGGACTTAGCACCCGG + Intergenic
1201885779 Y:18880295-18880317 GCAGTGAGGGGCTTAGCACCTGG + Intergenic
1201982629 Y:19923956-19923978 GCAATGAGGGACTTAGCACCCGG - Intergenic
1202109832 Y:21407322-21407344 GCAATGAGGGGCTTAGCACCCGG + Intergenic