ID: 1018551349

View in Genome Browser
Species Human (GRCh38)
Location 6:165001879-165001901
Sequence GGCAGTGGCCCCGGGCAGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018551349_1018551361 12 Left 1018551349 6:165001879-165001901 CCTCACTGCCCGGGGCCACTGCC No data
Right 1018551361 6:165001914-165001936 GTGCTGGCCCGCGAGCGCTGGGG No data
1018551349_1018551360 11 Left 1018551349 6:165001879-165001901 CCTCACTGCCCGGGGCCACTGCC No data
Right 1018551360 6:165001913-165001935 CGTGCTGGCCCGCGAGCGCTGGG No data
1018551349_1018551354 -4 Left 1018551349 6:165001879-165001901 CCTCACTGCCCGGGGCCACTGCC No data
Right 1018551354 6:165001898-165001920 TGCCCACCCGGAACTCGTGCTGG No data
1018551349_1018551362 13 Left 1018551349 6:165001879-165001901 CCTCACTGCCCGGGGCCACTGCC No data
Right 1018551362 6:165001915-165001937 TGCTGGCCCGCGAGCGCTGGGGG No data
1018551349_1018551359 10 Left 1018551349 6:165001879-165001901 CCTCACTGCCCGGGGCCACTGCC No data
Right 1018551359 6:165001912-165001934 TCGTGCTGGCCCGCGAGCGCTGG No data
1018551349_1018551365 23 Left 1018551349 6:165001879-165001901 CCTCACTGCCCGGGGCCACTGCC No data
Right 1018551365 6:165001925-165001947 CGAGCGCTGGGGGTTCCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018551349 Original CRISPR GGCAGTGGCCCCGGGCAGTG AGG (reversed) Intergenic
No off target data available for this crispr