ID: 1018551350

View in Genome Browser
Species Human (GRCh38)
Location 6:165001886-165001908
Sequence GCCCGGGGCCACTGCCCACC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018551343_1018551350 -2 Left 1018551343 6:165001865-165001887 CCTGGTACTAAGCCCCTCACTGC 0: 11
1: 569
2: 664
3: 424
4: 308
Right 1018551350 6:165001886-165001908 GCCCGGGGCCACTGCCCACCCGG No data
1018551336_1018551350 25 Left 1018551336 6:165001838-165001860 CCTGGCGCACCCTCCGCAGCTGC 0: 67
1: 199
2: 245
3: 310
4: 729
Right 1018551350 6:165001886-165001908 GCCCGGGGCCACTGCCCACCCGG No data
1018551340_1018551350 15 Left 1018551340 6:165001848-165001870 CCTCCGCAGCTGCTGGCCCTGGT No data
Right 1018551350 6:165001886-165001908 GCCCGGGGCCACTGCCCACCCGG No data
1018551341_1018551350 12 Left 1018551341 6:165001851-165001873 CCGCAGCTGCTGGCCCTGGTACT No data
Right 1018551350 6:165001886-165001908 GCCCGGGGCCACTGCCCACCCGG No data
1018551342_1018551350 -1 Left 1018551342 6:165001864-165001886 CCCTGGTACTAAGCCCCTCACTG No data
Right 1018551350 6:165001886-165001908 GCCCGGGGCCACTGCCCACCCGG No data
1018551338_1018551350 16 Left 1018551338 6:165001847-165001869 CCCTCCGCAGCTGCTGGCCCTGG No data
Right 1018551350 6:165001886-165001908 GCCCGGGGCCACTGCCCACCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018551350 Original CRISPR GCCCGGGGCCACTGCCCACC CGG Intergenic
No off target data available for this crispr