ID: 1018551353

View in Genome Browser
Species Human (GRCh38)
Location 6:165001894-165001916
Sequence CACGAGTTCCGGGTGGGCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018551353_1018551365 8 Left 1018551353 6:165001894-165001916 CCACTGCCCACCCGGAACTCGTG No data
Right 1018551365 6:165001925-165001947 CGAGCGCTGGGGGTTCCTGCTGG No data
1018551353_1018551360 -4 Left 1018551353 6:165001894-165001916 CCACTGCCCACCCGGAACTCGTG No data
Right 1018551360 6:165001913-165001935 CGTGCTGGCCCGCGAGCGCTGGG No data
1018551353_1018551359 -5 Left 1018551353 6:165001894-165001916 CCACTGCCCACCCGGAACTCGTG No data
Right 1018551359 6:165001912-165001934 TCGTGCTGGCCCGCGAGCGCTGG No data
1018551353_1018551361 -3 Left 1018551353 6:165001894-165001916 CCACTGCCCACCCGGAACTCGTG No data
Right 1018551361 6:165001914-165001936 GTGCTGGCCCGCGAGCGCTGGGG No data
1018551353_1018551362 -2 Left 1018551353 6:165001894-165001916 CCACTGCCCACCCGGAACTCGTG No data
Right 1018551362 6:165001915-165001937 TGCTGGCCCGCGAGCGCTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018551353 Original CRISPR CACGAGTTCCGGGTGGGCAG TGG (reversed) Intergenic
No off target data available for this crispr