ID: 1018551354

View in Genome Browser
Species Human (GRCh38)
Location 6:165001898-165001920
Sequence TGCCCACCCGGAACTCGTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018551338_1018551354 28 Left 1018551338 6:165001847-165001869 CCCTCCGCAGCTGCTGGCCCTGG No data
Right 1018551354 6:165001898-165001920 TGCCCACCCGGAACTCGTGCTGG No data
1018551342_1018551354 11 Left 1018551342 6:165001864-165001886 CCCTGGTACTAAGCCCCTCACTG No data
Right 1018551354 6:165001898-165001920 TGCCCACCCGGAACTCGTGCTGG No data
1018551341_1018551354 24 Left 1018551341 6:165001851-165001873 CCGCAGCTGCTGGCCCTGGTACT No data
Right 1018551354 6:165001898-165001920 TGCCCACCCGGAACTCGTGCTGG No data
1018551347_1018551354 -2 Left 1018551347 6:165001877-165001899 CCCCTCACTGCCCGGGGCCACTG No data
Right 1018551354 6:165001898-165001920 TGCCCACCCGGAACTCGTGCTGG No data
1018551340_1018551354 27 Left 1018551340 6:165001848-165001870 CCTCCGCAGCTGCTGGCCCTGGT No data
Right 1018551354 6:165001898-165001920 TGCCCACCCGGAACTCGTGCTGG No data
1018551349_1018551354 -4 Left 1018551349 6:165001879-165001901 CCTCACTGCCCGGGGCCACTGCC No data
Right 1018551354 6:165001898-165001920 TGCCCACCCGGAACTCGTGCTGG No data
1018551348_1018551354 -3 Left 1018551348 6:165001878-165001900 CCCTCACTGCCCGGGGCCACTGC No data
Right 1018551354 6:165001898-165001920 TGCCCACCCGGAACTCGTGCTGG No data
1018551343_1018551354 10 Left 1018551343 6:165001865-165001887 CCTGGTACTAAGCCCCTCACTGC 0: 11
1: 569
2: 664
3: 424
4: 308
Right 1018551354 6:165001898-165001920 TGCCCACCCGGAACTCGTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018551354 Original CRISPR TGCCCACCCGGAACTCGTGC TGG Intergenic
No off target data available for this crispr