ID: 1018551360

View in Genome Browser
Species Human (GRCh38)
Location 6:165001913-165001935
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018551342_1018551360 26 Left 1018551342 6:165001864-165001886 CCCTGGTACTAAGCCCCTCACTG No data
Right 1018551360 6:165001913-165001935 CGTGCTGGCCCGCGAGCGCTGGG No data
1018551352_1018551360 2 Left 1018551352 6:165001888-165001910 CCGGGGCCACTGCCCACCCGGAA No data
Right 1018551360 6:165001913-165001935 CGTGCTGGCCCGCGAGCGCTGGG No data
1018551343_1018551360 25 Left 1018551343 6:165001865-165001887 CCTGGTACTAAGCCCCTCACTGC 0: 11
1: 569
2: 664
3: 424
4: 308
Right 1018551360 6:165001913-165001935 CGTGCTGGCCCGCGAGCGCTGGG No data
1018551351_1018551360 3 Left 1018551351 6:165001887-165001909 CCCGGGGCCACTGCCCACCCGGA No data
Right 1018551360 6:165001913-165001935 CGTGCTGGCCCGCGAGCGCTGGG No data
1018551349_1018551360 11 Left 1018551349 6:165001879-165001901 CCTCACTGCCCGGGGCCACTGCC No data
Right 1018551360 6:165001913-165001935 CGTGCTGGCCCGCGAGCGCTGGG No data
1018551355_1018551360 -10 Left 1018551355 6:165001900-165001922 CCCACCCGGAACTCGTGCTGGCC 0: 44
1: 219
2: 940
3: 707
4: 376
Right 1018551360 6:165001913-165001935 CGTGCTGGCCCGCGAGCGCTGGG No data
1018551348_1018551360 12 Left 1018551348 6:165001878-165001900 CCCTCACTGCCCGGGGCCACTGC No data
Right 1018551360 6:165001913-165001935 CGTGCTGGCCCGCGAGCGCTGGG No data
1018551353_1018551360 -4 Left 1018551353 6:165001894-165001916 CCACTGCCCACCCGGAACTCGTG No data
Right 1018551360 6:165001913-165001935 CGTGCTGGCCCGCGAGCGCTGGG No data
1018551347_1018551360 13 Left 1018551347 6:165001877-165001899 CCCCTCACTGCCCGGGGCCACTG No data
Right 1018551360 6:165001913-165001935 CGTGCTGGCCCGCGAGCGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018551360 Original CRISPR CGTGCTGGCCCGCGAGCGCT GGG Intergenic
No off target data available for this crispr