ID: 1018551365

View in Genome Browser
Species Human (GRCh38)
Location 6:165001925-165001947
Sequence CGAGCGCTGGGGGTTCCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018551348_1018551365 24 Left 1018551348 6:165001878-165001900 CCCTCACTGCCCGGGGCCACTGC No data
Right 1018551365 6:165001925-165001947 CGAGCGCTGGGGGTTCCTGCTGG No data
1018551351_1018551365 15 Left 1018551351 6:165001887-165001909 CCCGGGGCCACTGCCCACCCGGA No data
Right 1018551365 6:165001925-165001947 CGAGCGCTGGGGGTTCCTGCTGG No data
1018551358_1018551365 -3 Left 1018551358 6:165001905-165001927 CCGGAACTCGTGCTGGCCCGCGA No data
Right 1018551365 6:165001925-165001947 CGAGCGCTGGGGGTTCCTGCTGG No data
1018551347_1018551365 25 Left 1018551347 6:165001877-165001899 CCCCTCACTGCCCGGGGCCACTG No data
Right 1018551365 6:165001925-165001947 CGAGCGCTGGGGGTTCCTGCTGG No data
1018551356_1018551365 1 Left 1018551356 6:165001901-165001923 CCACCCGGAACTCGTGCTGGCCC 0: 30
1: 190
2: 824
3: 728
4: 472
Right 1018551365 6:165001925-165001947 CGAGCGCTGGGGGTTCCTGCTGG No data
1018551353_1018551365 8 Left 1018551353 6:165001894-165001916 CCACTGCCCACCCGGAACTCGTG No data
Right 1018551365 6:165001925-165001947 CGAGCGCTGGGGGTTCCTGCTGG No data
1018551357_1018551365 -2 Left 1018551357 6:165001904-165001926 CCCGGAACTCGTGCTGGCCCGCG No data
Right 1018551365 6:165001925-165001947 CGAGCGCTGGGGGTTCCTGCTGG No data
1018551355_1018551365 2 Left 1018551355 6:165001900-165001922 CCCACCCGGAACTCGTGCTGGCC 0: 44
1: 219
2: 940
3: 707
4: 376
Right 1018551365 6:165001925-165001947 CGAGCGCTGGGGGTTCCTGCTGG No data
1018551349_1018551365 23 Left 1018551349 6:165001879-165001901 CCTCACTGCCCGGGGCCACTGCC No data
Right 1018551365 6:165001925-165001947 CGAGCGCTGGGGGTTCCTGCTGG No data
1018551352_1018551365 14 Left 1018551352 6:165001888-165001910 CCGGGGCCACTGCCCACCCGGAA No data
Right 1018551365 6:165001925-165001947 CGAGCGCTGGGGGTTCCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018551365 Original CRISPR CGAGCGCTGGGGGTTCCTGC TGG Intergenic
No off target data available for this crispr