ID: 1018552717

View in Genome Browser
Species Human (GRCh38)
Location 6:165016664-165016686
Sequence ACACCGCATGTTCTCACAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018552717_1018552721 17 Left 1018552717 6:165016664-165016686 CCCACTGTGAGAACATGCGGTGT No data
Right 1018552721 6:165016704-165016726 CGATAGTTTTCTGAGAATGATGG 0: 24
1: 5462
2: 7912
3: 8755
4: 5827

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018552717 Original CRISPR ACACCGCATGTTCTCACAGT GGG (reversed) Intergenic
No off target data available for this crispr