ID: 1018553278

View in Genome Browser
Species Human (GRCh38)
Location 6:165023457-165023479
Sequence ATTCTTGTTGTTCCACATCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018553278_1018553279 9 Left 1018553278 6:165023457-165023479 CCAGGATGTGGAACAACAAGAAT No data
Right 1018553279 6:165023489-165023511 CTGCTAGTGAGAATGCAAAGTGG No data
1018553278_1018553280 23 Left 1018553278 6:165023457-165023479 CCAGGATGTGGAACAACAAGAAT No data
Right 1018553280 6:165023503-165023525 GCAAAGTGGTCTAGCCACGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018553278 Original CRISPR ATTCTTGTTGTTCCACATCC TGG (reversed) Intergenic
No off target data available for this crispr