ID: 1018554784

View in Genome Browser
Species Human (GRCh38)
Location 6:165037884-165037906
Sequence TGGTAGGATTAGACTTCTAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018554784_1018554793 6 Left 1018554784 6:165037884-165037906 CCCCTAGAAGTCTAATCCTACCA No data
Right 1018554793 6:165037913-165037935 CCAGCATCAGGCTTCAAGTCAGG No data
1018554784_1018554788 -6 Left 1018554784 6:165037884-165037906 CCCCTAGAAGTCTAATCCTACCA No data
Right 1018554788 6:165037901-165037923 CTACCACCAATCCCAGCATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018554784 Original CRISPR TGGTAGGATTAGACTTCTAG GGG (reversed) Intergenic
No off target data available for this crispr