ID: 1018566435

View in Genome Browser
Species Human (GRCh38)
Location 6:165159581-165159603
Sequence ATGTAGTTTTTTTGATAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018566435_1018566441 30 Left 1018566435 6:165159581-165159603 CCTTCTTATCAAAAAAACTACAT No data
Right 1018566441 6:165159634-165159656 CACTGTCATCTGGTAGATGATGG No data
1018566435_1018566437 -5 Left 1018566435 6:165159581-165159603 CCTTCTTATCAAAAAAACTACAT No data
Right 1018566437 6:165159599-165159621 TACATGTGCCAGGCACTAGCAGG No data
1018566435_1018566438 2 Left 1018566435 6:165159581-165159603 CCTTCTTATCAAAAAAACTACAT No data
Right 1018566438 6:165159606-165159628 GCCAGGCACTAGCAGGCAAGAGG No data
1018566435_1018566440 20 Left 1018566435 6:165159581-165159603 CCTTCTTATCAAAAAAACTACAT No data
Right 1018566440 6:165159624-165159646 AGAGGCTGCTCACTGTCATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018566435 Original CRISPR ATGTAGTTTTTTTGATAAGA AGG (reversed) Intergenic
No off target data available for this crispr