ID: 1018570730

View in Genome Browser
Species Human (GRCh38)
Location 6:165206891-165206913
Sequence CTGCCATTTCTTATGGCACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018570730_1018570739 22 Left 1018570730 6:165206891-165206913 CCCTGTGCCATAAGAAATGGCAG No data
Right 1018570739 6:165206936-165206958 TGGCCTCAATGTGGCCATGTGGG No data
1018570730_1018570740 23 Left 1018570730 6:165206891-165206913 CCCTGTGCCATAAGAAATGGCAG No data
Right 1018570740 6:165206937-165206959 GGCCTCAATGTGGCCATGTGGGG No data
1018570730_1018570738 21 Left 1018570730 6:165206891-165206913 CCCTGTGCCATAAGAAATGGCAG No data
Right 1018570738 6:165206935-165206957 ATGGCCTCAATGTGGCCATGTGG No data
1018570730_1018570737 13 Left 1018570730 6:165206891-165206913 CCCTGTGCCATAAGAAATGGCAG No data
Right 1018570737 6:165206927-165206949 CAACTAGAATGGCCTCAATGTGG No data
1018570730_1018570734 2 Left 1018570730 6:165206891-165206913 CCCTGTGCCATAAGAAATGGCAG No data
Right 1018570734 6:165206916-165206938 TTGGCCTGCCACAACTAGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018570730 Original CRISPR CTGCCATTTCTTATGGCACA GGG (reversed) Intergenic
No off target data available for this crispr