ID: 1018571532

View in Genome Browser
Species Human (GRCh38)
Location 6:165216280-165216302
Sequence CACTTCCCAATGCTGTTGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018571525_1018571532 -1 Left 1018571525 6:165216258-165216280 CCAAATACTTCCCCTTTGACCCC No data
Right 1018571532 6:165216280-165216302 CACTTCCCAATGCTGTTGCATGG No data
1018571523_1018571532 27 Left 1018571523 6:165216230-165216252 CCATTATTGAGGGCTGAGCTCTC No data
Right 1018571532 6:165216280-165216302 CACTTCCCAATGCTGTTGCATGG No data
1018571524_1018571532 0 Left 1018571524 6:165216257-165216279 CCCAAATACTTCCCCTTTGACCC No data
Right 1018571532 6:165216280-165216302 CACTTCCCAATGCTGTTGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018571532 Original CRISPR CACTTCCCAATGCTGTTGCA TGG Intergenic
No off target data available for this crispr