ID: 1018573472

View in Genome Browser
Species Human (GRCh38)
Location 6:165234107-165234129
Sequence TAGACTGAGCAGAGGGATGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018573472_1018573480 19 Left 1018573472 6:165234107-165234129 CCAGCATCCCTCTGCTCAGTCTA No data
Right 1018573480 6:165234149-165234171 GGCCCCAGTGTGGCAGAGAAAGG No data
1018573472_1018573479 9 Left 1018573472 6:165234107-165234129 CCAGCATCCCTCTGCTCAGTCTA No data
Right 1018573479 6:165234139-165234161 GTCATCACTAGGCCCCAGTGTGG No data
1018573472_1018573476 -2 Left 1018573472 6:165234107-165234129 CCAGCATCCCTCTGCTCAGTCTA No data
Right 1018573476 6:165234128-165234150 TACCCTCTGCGGTCATCACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018573472 Original CRISPR TAGACTGAGCAGAGGGATGC TGG (reversed) Intergenic
No off target data available for this crispr