ID: 1018573472 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 6:165234107-165234129 |
Sequence | TAGACTGAGCAGAGGGATGC TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1018573472_1018573480 | 19 | Left | 1018573472 | 6:165234107-165234129 | CCAGCATCCCTCTGCTCAGTCTA | No data | ||
Right | 1018573480 | 6:165234149-165234171 | GGCCCCAGTGTGGCAGAGAAAGG | No data | ||||
1018573472_1018573479 | 9 | Left | 1018573472 | 6:165234107-165234129 | CCAGCATCCCTCTGCTCAGTCTA | No data | ||
Right | 1018573479 | 6:165234139-165234161 | GTCATCACTAGGCCCCAGTGTGG | No data | ||||
1018573472_1018573476 | -2 | Left | 1018573472 | 6:165234107-165234129 | CCAGCATCCCTCTGCTCAGTCTA | No data | ||
Right | 1018573476 | 6:165234128-165234150 | TACCCTCTGCGGTCATCACTAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1018573472 | Original CRISPR | TAGACTGAGCAGAGGGATGC TGG (reversed) | Intergenic | ||
No off target data available for this crispr |