ID: 1018577705

View in Genome Browser
Species Human (GRCh38)
Location 6:165276753-165276775
Sequence TTCCATGAGGATGAGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018577705_1018577713 -8 Left 1018577705 6:165276753-165276775 CCTTCCTCCTCATCCTCATGGAA No data
Right 1018577713 6:165276768-165276790 TCATGGAAGGTCGGGGACCAAGG No data
1018577705_1018577714 3 Left 1018577705 6:165276753-165276775 CCTTCCTCCTCATCCTCATGGAA No data
Right 1018577714 6:165276779-165276801 CGGGGACCAAGGATTGCTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018577705 Original CRISPR TTCCATGAGGATGAGGAGGA AGG (reversed) Intergenic
No off target data available for this crispr