ID: 1018578068

View in Genome Browser
Species Human (GRCh38)
Location 6:165280544-165280566
Sequence GCTTTTTCTGCCCCATAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 121}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018578061_1018578068 22 Left 1018578061 6:165280499-165280521 CCTGTATGGCTTGCTCAGCACTC 0: 1
1: 0
2: 0
3: 7
4: 89
Right 1018578068 6:165280544-165280566 GCTTTTTCTGCCCCATAAGCTGG 0: 1
1: 0
2: 0
3: 7
4: 121
1018578060_1018578068 25 Left 1018578060 6:165280496-165280518 CCACCTGTATGGCTTGCTCAGCA 0: 1
1: 0
2: 0
3: 8
4: 149
Right 1018578068 6:165280544-165280566 GCTTTTTCTGCCCCATAAGCTGG 0: 1
1: 0
2: 0
3: 7
4: 121
1018578064_1018578068 -9 Left 1018578064 6:165280530-165280552 CCCTTTCTCCCATGGCTTTTTCT 0: 1
1: 0
2: 5
3: 77
4: 682
Right 1018578068 6:165280544-165280566 GCTTTTTCTGCCCCATAAGCTGG 0: 1
1: 0
2: 0
3: 7
4: 121
1018578065_1018578068 -10 Left 1018578065 6:165280531-165280553 CCTTTCTCCCATGGCTTTTTCTG 0: 1
1: 0
2: 0
3: 48
4: 487
Right 1018578068 6:165280544-165280566 GCTTTTTCTGCCCCATAAGCTGG 0: 1
1: 0
2: 0
3: 7
4: 121
1018578063_1018578068 -4 Left 1018578063 6:165280525-165280547 CCAATCCCTTTCTCCCATGGCTT 0: 1
1: 0
2: 3
3: 38
4: 434
Right 1018578068 6:165280544-165280566 GCTTTTTCTGCCCCATAAGCTGG 0: 1
1: 0
2: 0
3: 7
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018578068 Original CRISPR GCTTTTTCTGCCCCATAAGC TGG Intronic
902393164 1:16117964-16117986 CCTACTACTGCCCCATAAGCTGG - Intergenic
905750361 1:40457322-40457344 GTCTTTTCTTCCCCATAAGCAGG + Exonic
906494740 1:46296562-46296584 TCTTTTGCTGCCCCATAACTAGG - Intronic
908618124 1:65946092-65946114 GCTTTTTCTCCCTCATCAACAGG + Intronic
909546732 1:76856423-76856445 TCTTTTTCTGCCCCATGAGACGG - Intergenic
912854325 1:113153554-113153576 GCTTTTTCCCCCTCATAATCTGG - Intergenic
915599231 1:156912331-156912353 GCTGTATCTGCCCCCTAGGCTGG + Exonic
917239307 1:172930244-172930266 GATTTGTCTGCCTCATAAGGTGG - Intergenic
917489464 1:175485609-175485631 GCTTTTCCTGCCACACATGCTGG + Intronic
1064531656 10:16316582-16316604 GTTTTTTCTGTCCCATAAAGCGG - Intergenic
1067123371 10:43493999-43494021 TCTTGTTCTGCCGCCTAAGCTGG - Intergenic
1068275612 10:54792084-54792106 CCTTATTCTGGCCCATAATCTGG + Intronic
1070451453 10:76561654-76561676 GCATCTTCTGCCCCATATACAGG - Intergenic
1071494109 10:86155941-86155963 GCTTTGTCCTCCCCATCAGCAGG - Intronic
1073251320 10:102121571-102121593 GCTTTAGCTGCCTCATAAACAGG + Intergenic
1075821499 10:125316763-125316785 GCTGTGTCTGCCCAAGAAGCAGG - Intergenic
1076497473 10:130906285-130906307 GCTGTTCCTGCAGCATAAGCTGG + Intergenic
1081646778 11:44795682-44795704 CCATTTTCTGCCCCAGGAGCCGG + Intronic
1087316485 11:96609299-96609321 GCATTTTCTACCTCATAAGTGGG - Intergenic
1087768243 11:102179499-102179521 GCTTATTCTGCCCCATCCACAGG + Intronic
1088016665 11:105069492-105069514 TCTTTTTCTGCTCCATCATCTGG - Intronic
1089812806 11:121145569-121145591 GCTCTATCTGCCCCTGAAGCTGG + Exonic
1091292519 11:134449745-134449767 GCTTTTGCAGCCCCATGTGCAGG + Intergenic
1091501112 12:1018946-1018968 CCTTCTTCTGCCCCATCAACTGG - Intronic
1091772573 12:3162668-3162690 TCTTCTTCTGGCCCAAAAGCAGG - Intronic
1098011892 12:66061987-66062009 GCTTTTTAGGCCACTTAAGCTGG - Intergenic
1099163150 12:79270707-79270729 GCTATTTCTGTCCCCTAGGCTGG - Intronic
1099791986 12:87347611-87347633 GCTTATTCTTCCCCATCTGCTGG - Intergenic
1101837561 12:108305917-108305939 GCTTTTCCTGGCCTCTAAGCAGG - Intronic
1103315520 12:120051833-120051855 TCTTTTTCTGCTCCAGAATCCGG + Intronic
1103767290 12:123289795-123289817 GCTCTCTCTGCCCCATAAAGTGG + Exonic
1105236166 13:18555416-18555438 GCTTTCTCTGCTCCATACCCAGG - Intergenic
1111086876 13:83387215-83387237 GCTTCTTCTGCCTCAGTAGCTGG + Intergenic
1114730960 14:24992142-24992164 GCTTTTTCAGCTCCATAATATGG - Intronic
1116458962 14:45148860-45148882 GCTCTATCTGCCCAATTAGCAGG - Exonic
1126532252 15:49724106-49724128 GCTTTTGCTGTCATATAAGCAGG - Intergenic
1129189959 15:73931363-73931385 GGTTTATCTGCCCCACATGCAGG - Intronic
1130752713 15:86729502-86729524 GCATGTTCTCCCTCATAAGCAGG - Intronic
1140539441 16:75742908-75742930 GCTTTTTTTGCCCCTTAAAATGG + Intronic
1140786140 16:78343980-78344002 TCTTTTTCTGCCCCTCATGCCGG + Intronic
1149289489 17:55202804-55202826 TCTTGTTCTTCCCCAAAAGCTGG + Intergenic
1150973316 17:70055475-70055497 CCTGTTTCTTCCCCAGAAGCAGG + Intronic
1151239295 17:72745271-72745293 GCCATTTCTGCCCCAGCAGCGGG - Intronic
1152627563 17:81394846-81394868 GCTTTTGCTGCCCAAGCAGCGGG + Intergenic
1154513375 18:15134582-15134604 GCTTTCTCTGCTCCATACCCAGG + Intergenic
1157070115 18:44396782-44396804 GCTCTCACTGCCCCATCAGCAGG + Intergenic
1157892254 18:51428824-51428846 GCTTTTTCTGCTCCTTTACCAGG + Intergenic
1161526491 19:4759355-4759377 GCTTCTTATGCCCCAGAAGCAGG - Intergenic
1162556247 19:11387867-11387889 TCTTTTTCTGTCGCCTAAGCTGG + Intronic
1165791677 19:38496455-38496477 GCTATTTCTGCCGAATCAGCCGG + Exonic
1168029295 19:53666843-53666865 GCTTGTTCTGCGCCATAAACTGG + Intergenic
1168029631 19:53669327-53669349 GCTTGTTCTGCGCCATAAACTGG + Intergenic
925426677 2:3754416-3754438 GCGTTTTCTGCTCCCAAAGCTGG + Intronic
925812299 2:7712492-7712514 TCTTTTTCTGTCACCTAAGCTGG + Intergenic
926960574 2:18354305-18354327 TCTGTTTCTTCACCATAAGCAGG - Intronic
929176710 2:38985549-38985571 ACTTTTTCTGGCCAATAGGCAGG - Exonic
930847332 2:55919923-55919945 GCTTTTGCTGGCCCATGAGTAGG + Intronic
932628371 2:73317342-73317364 GCTTTTTTTCCTCCATGAGCGGG + Intergenic
934936855 2:98472002-98472024 TCTTTTTGTGCCCCACAAGGAGG + Intronic
937205641 2:120235434-120235456 GCTTGTTCTCCCTCATAAGTGGG + Intergenic
938513621 2:131979193-131979215 GCTTTCTCTGCTCCATACCCAGG + Intergenic
942319797 2:174726282-174726304 TCATTTTCTGCCCCAGCAGCAGG - Intergenic
942917360 2:181327526-181327548 CCTCTTTCTGCCCTAGAAGCTGG + Intergenic
943536110 2:189152687-189152709 GCTTTTTCTGGCCCAGGACCAGG + Intronic
1170841542 20:19928359-19928381 GATTTTTCTGAGCCAAAAGCTGG + Intronic
1172304208 20:33870170-33870192 CCTCATTCTGCTCCATAAGCAGG + Intergenic
1173688571 20:44941378-44941400 CCTTTTATTGCCTCATAAGCAGG - Intronic
1176780164 21:13183701-13183723 GCTTTCTCTGCTCCATACCCAGG - Intergenic
1177977816 21:27872719-27872741 GCTTTCTCTGCTCCATAACCAGG - Intergenic
1179392124 21:41003553-41003575 CCTGTTTGTGCCCCATAAGTGGG - Intergenic
1183179719 22:36251994-36252016 TCTCTTCCTGCCTCATAAGCTGG + Intergenic
949370586 3:3330115-3330137 TTTTTTTCTCCCCCAGAAGCTGG + Intergenic
950895691 3:16448737-16448759 CCTTCTTCTGCCCCATTGGCAGG + Intronic
951250811 3:20392456-20392478 GCTTTTTTTCCCCCATCAACTGG + Intergenic
951919408 3:27838029-27838051 TCTTGCTCTGCCCCCTAAGCTGG + Intergenic
952172835 3:30827943-30827965 CCTTTTTCTGCTACATTAGCTGG + Intronic
957198642 3:77103079-77103101 GCTCCTTCTGCTCCATAAACAGG - Intronic
962276627 3:134019594-134019616 CCTTTTTGAGCCCCATGAGCTGG + Intronic
962335602 3:134527547-134527569 GCTTTTCTTGCCCCACCAGCAGG - Intronic
963693894 3:148540573-148540595 CCATTTTCTGCCCCAAAGGCTGG - Intergenic
964827416 3:160844069-160844091 GGTTTTTCTGGCTCAAAAGCAGG - Intronic
968986643 4:3879254-3879276 GCTTCTCCTGCCCCCTCAGCTGG - Intergenic
969870147 4:10099424-10099446 GCTTTTTCTGATGCCTAAGCAGG - Intronic
971036558 4:22699885-22699907 GGTTTTTCTTCTCCATAAACAGG - Intergenic
974416272 4:61611201-61611223 CCTCTGTCTGCCCCATAGGCTGG - Intronic
975681762 4:76884502-76884524 ACTATTTCTGGCCCATTAGCAGG + Intergenic
976049656 4:80996651-80996673 CCCTTTTCTGCCACATAAACTGG - Intergenic
976436501 4:85024572-85024594 ACTTTTTCTTCCCCAAAAGTGGG + Intergenic
979624567 4:122830202-122830224 GCAATTTCTTCCCCAAAAGCTGG + Intronic
982423663 4:155229757-155229779 CCTATTTCTGCCCCACAAGCTGG - Intergenic
982762849 4:159307939-159307961 TCTTGCTCTGCCCCATAGGCTGG - Intronic
982864090 4:160488673-160488695 GCTTTTTCTTCCCCAAATGGGGG + Intergenic
984507068 4:180633299-180633321 GCTTTCTCTGTCCCATAACTAGG + Intergenic
987548670 5:19348825-19348847 GCTTTTTCTTCTCCCAAAGCTGG - Intergenic
988357706 5:30199452-30199474 TCTTTTTCTGCCCTATGACCTGG + Intergenic
991493554 5:67206468-67206490 GCTTATTCTGCCATATAAACTGG - Intergenic
993604348 5:89969957-89969979 GCTTTTTCTGGTCCAGAAGAGGG + Intergenic
999730177 5:154471274-154471296 GCATTTTCCTCCCCATAATCTGG - Intergenic
1000305562 5:159991516-159991538 TCTCTCTCTGCCTCATAAGCGGG + Intergenic
1000686526 5:164256217-164256239 GCATTTTCTGTCCCATAAATAGG - Intergenic
1007808562 6:44470008-44470030 GCTGTGGCTGCCCCATAAACCGG - Intergenic
1008134919 6:47763562-47763584 GCATTTTCTCACTCATAAGCGGG - Intergenic
1012836369 6:104274710-104274732 GCTATTTCTGCCACATCTGCAGG + Intergenic
1012918711 6:105198726-105198748 GCTATTTCCGCCCCATCTGCAGG - Intergenic
1018578068 6:165280544-165280566 GCTTTTTCTGCCCCATAAGCTGG + Intronic
1024383263 7:48723318-48723340 TCTTTCTCTGCCCCATGACCAGG + Intergenic
1029881129 7:103811213-103811235 GCTTCTATTGCCCCACAAGCAGG - Intronic
1033344638 7:140517681-140517703 GCGTTTTCTGGACCAGAAGCAGG - Intergenic
1036637152 8:10559231-10559253 GCTTTTTCCTGGCCATAAGCAGG - Intergenic
1036796462 8:11759702-11759724 GCTGTTTCTGCCCCTGATGCTGG + Exonic
1039918648 8:41877561-41877583 GCTTTTTCTGTCTCCTAAACTGG - Intronic
1040694169 8:49976414-49976436 GCTTATTCAGCCCCACAACCTGG - Intronic
1044664995 8:94625516-94625538 TCTTTTTCTGCCTCTCAAGCTGG - Intergenic
1045048383 8:98300863-98300885 CCTTTCCCTGCCCCATCAGCAGG - Intergenic
1046365587 8:113226741-113226763 TCTTTTCCTGCCCCTGAAGCAGG + Intronic
1048653649 8:136510698-136510720 GCTGTTTATGACCCATAAGGCGG + Intergenic
1049949803 9:633106-633128 ACTTTTAGTGCCCCATAAGAAGG + Intronic
1051516144 9:17932326-17932348 GCTTTATCTGCTCCATACCCGGG - Intergenic
1055109180 9:72542588-72542610 TCTTTTTCTCCCCCCTAGGCTGG - Intronic
1058056861 9:100457519-100457541 TCTTTTTCTGTCCCATCATCTGG + Intronic
1061055152 9:128218566-128218588 GCATATTCTGCTCCAGAAGCGGG - Exonic
1062419616 9:136473751-136473773 GCTCTTTTTGTCACATAAGCTGG + Intronic
1187778923 X:22795316-22795338 GCATGTTCTCACCCATAAGCGGG + Intergenic
1193960151 X:87914877-87914899 GCCTTTTCTGCCCTGCAAGCAGG - Intergenic
1194925673 X:99820280-99820302 GCCTTGTCTACCCCACAAGCGGG - Intergenic
1195283441 X:103359163-103359185 GCGTTTTCTGCCCCTTCTGCTGG + Intergenic
1199618438 X:149677703-149677725 CCTTCTTCTGCCCCATCACCTGG - Intergenic
1199624204 X:149725546-149725568 CCTTCTTCTGCCCCATCACCTGG + Intergenic
1201609180 Y:15822078-15822100 GCTTATTCTCACTCATAAGCAGG + Intergenic