ID: 1018581081

View in Genome Browser
Species Human (GRCh38)
Location 6:165308761-165308783
Sequence CTGAGGTTCAGGTGGTCAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018581075_1018581081 2 Left 1018581075 6:165308736-165308758 CCATCCTCCTTTACAGGAGGGGA 0: 1
1: 0
2: 3
3: 18
4: 225
Right 1018581081 6:165308761-165308783 CTGAGGTTCAGGTGGTCAGATGG No data
1018581077_1018581081 -5 Left 1018581077 6:165308743-165308765 CCTTTACAGGAGGGGAAACTGAG 0: 1
1: 3
2: 41
3: 171
4: 627
Right 1018581081 6:165308761-165308783 CTGAGGTTCAGGTGGTCAGATGG No data
1018581070_1018581081 7 Left 1018581070 6:165308731-165308753 CCGTCCCATCCTCCTTTACAGGA 0: 1
1: 0
2: 5
3: 47
4: 315
Right 1018581081 6:165308761-165308783 CTGAGGTTCAGGTGGTCAGATGG No data
1018581067_1018581081 22 Left 1018581067 6:165308716-165308738 CCCAGGAGGTAGGCGCCGTCCCA 0: 1
1: 0
2: 0
3: 6
4: 64
Right 1018581081 6:165308761-165308783 CTGAGGTTCAGGTGGTCAGATGG No data
1018581073_1018581081 3 Left 1018581073 6:165308735-165308757 CCCATCCTCCTTTACAGGAGGGG 0: 1
1: 0
2: 1
3: 14
4: 128
Right 1018581081 6:165308761-165308783 CTGAGGTTCAGGTGGTCAGATGG No data
1018581068_1018581081 21 Left 1018581068 6:165308717-165308739 CCAGGAGGTAGGCGCCGTCCCAT 0: 1
1: 0
2: 0
3: 1
4: 59
Right 1018581081 6:165308761-165308783 CTGAGGTTCAGGTGGTCAGATGG No data
1018581076_1018581081 -2 Left 1018581076 6:165308740-165308762 CCTCCTTTACAGGAGGGGAAACT 0: 1
1: 1
2: 15
3: 261
4: 1494
Right 1018581081 6:165308761-165308783 CTGAGGTTCAGGTGGTCAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018581081 Original CRISPR CTGAGGTTCAGGTGGTCAGA TGG Intronic
No off target data available for this crispr