ID: 1018584693

View in Genome Browser
Species Human (GRCh38)
Location 6:165344498-165344520
Sequence ATGTGGACCTAGAAGAGGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 1, 1: 0, 2: 3, 3: 10, 4: 169}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018584693_1018584696 -9 Left 1018584693 6:165344498-165344520 CCTTACCTCTTCTAGGTCCACAT 0: 1
1: 0
2: 3
3: 10
4: 169
Right 1018584696 6:165344512-165344534 GGTCCACATTCTCCAACTGCGGG 0: 1
1: 0
2: 2
3: 12
4: 139
1018584693_1018584695 -10 Left 1018584693 6:165344498-165344520 CCTTACCTCTTCTAGGTCCACAT 0: 1
1: 0
2: 3
3: 10
4: 169
Right 1018584695 6:165344511-165344533 AGGTCCACATTCTCCAACTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018584693 Original CRISPR ATGTGGACCTAGAAGAGGTA AGG (reversed) Intronic
900650651 1:3728469-3728491 ATGTGTACATAGCACAGGTAGGG + Intronic
904331641 1:29761594-29761616 CTGTGGATCTAGAACAGGAAAGG - Intergenic
904706028 1:32391478-32391500 ATGTGGGCCCAGATGAGGTTGGG + Intronic
904893065 1:33793751-33793773 GTGTGGACGGAGAAGAGGGAGGG + Intronic
905792012 1:40794849-40794871 CTGTGGAGCCAGAAGAGGGAGGG + Intronic
906751580 1:48267498-48267520 ATGGGGAGCTAGAAGGGGGATGG + Intergenic
908140122 1:61175578-61175600 TTGAGGACCTGGAGGAGGTATGG - Intronic
909741722 1:79037443-79037465 CTGTGTGCCTAGAAGAGCTATGG + Intergenic
911430028 1:97773781-97773803 ATGGGGAGCTAGAAGGGGGATGG - Intronic
912512233 1:110197474-110197496 ATGTAGAAATAGAAGCGGTAGGG - Exonic
912976565 1:114336350-114336372 ATGAGGACATGGAAGAGGTGTGG - Intergenic
914927156 1:151898359-151898381 TTGTGTACCTAGAAGAATTATGG - Intronic
917177471 1:172252827-172252849 ATATGAACATTGAAGAGGTAAGG - Intronic
918445064 1:184609177-184609199 ATGTGGAGAAAGAAGAGGTTGGG - Intronic
918532928 1:185542829-185542851 ATGAGAAGCAAGAAGAGGTAAGG - Intergenic
919048162 1:192480347-192480369 ATGGGGAGCTAGAAGGGGGATGG - Intergenic
921403533 1:214753476-214753498 ATGGGGAGCCAGAAGAGGGATGG - Intergenic
921948426 1:220905019-220905041 AGGTGGCCCTAGGAGAGGAAGGG - Intergenic
923517058 1:234706890-234706912 ATATGGATATAGAAGGGGTAAGG + Intergenic
923518667 1:234719415-234719437 ATGTGGAGGGAGAGGAGGTAAGG + Intergenic
1064795817 10:19010040-19010062 ATGGGGAGCCAGAAGAGGTATGG + Intergenic
1066590129 10:36985642-36985664 GTGTGGAACAAGAAGAGGTAGGG - Intergenic
1068061639 10:52075405-52075427 ATGTGGACCTAGAATTTATATGG + Intronic
1068504534 10:57882996-57883018 ATGTGGAGCTAGAGCTGGTATGG + Intergenic
1071262707 10:83935278-83935300 CTGTGTACCCAGCAGAGGTAGGG - Intergenic
1071284673 10:84133517-84133539 ATGTGGAGCGAGAACAGGCAGGG - Intergenic
1071746029 10:88420499-88420521 ATCTGAAACTAGAAGAGCTATGG - Intronic
1074314258 10:112347337-112347359 ATGTGGAGCTAGGACAGGTCAGG - Intergenic
1075618160 10:123906280-123906302 ATGTCTACCTAGAAGAGAGATGG + Intronic
1079748095 11:24158469-24158491 ATTTGGACCTAAAAGAACTAAGG + Intergenic
1080472384 11:32558935-32558957 ATGGGGAACTAGGAGAGGCAAGG - Intergenic
1085897951 11:80662380-80662402 GTGTGGAACAAGAAGAGGTAGGG + Intergenic
1087396970 11:97611384-97611406 ATGTGGAGCCAGAAAGGGTATGG + Intergenic
1087910786 11:103751164-103751186 ATGTGGGGATAGAAGAGGTGAGG + Intergenic
1089065809 11:115660915-115660937 TGGTGGTCCTAGAAAAGGTATGG + Intergenic
1092204813 12:6608205-6608227 CTGTGGAGCTAGAAGAGGGAAGG - Intergenic
1092236037 12:6810195-6810217 ATGAAGACTTAAAAGAGGTATGG - Intronic
1092621694 12:10278505-10278527 ATGTGGACCAAGAAGAGATGAGG - Intergenic
1095639381 12:44469173-44469195 ATCTAAACATAGAAGAGGTATGG + Intergenic
1096675648 12:53224360-53224382 AGGTGGCCCTTGAAGAGGTCTGG - Intronic
1098396849 12:70028581-70028603 ATGGGGAGCTAGAAGGGGTATGG + Intergenic
1099097547 12:78393844-78393866 ATGTGAAAGTAGAAGAAGTAAGG + Intergenic
1099218272 12:79879947-79879969 ATGTGGAGCTTGAGGAGGCAAGG - Intronic
1102747057 12:115258461-115258483 AGGTGGAAACAGAAGAGGTAGGG + Intergenic
1106863523 13:33937175-33937197 ATCTGAACATAGAAAAGGTAAGG - Intronic
1107571935 13:41670907-41670929 ATGTGCACCTCTAAGAGATAAGG + Intronic
1108334376 13:49423839-49423861 TTGTAGACCTAGAAAAGTTAAGG + Intronic
1109284055 13:60391234-60391256 ATGTGGGCTGGGAAGAGGTAAGG - Intergenic
1110484264 13:76019768-76019790 ATGGGGACCCAGAAGGGGCATGG + Intergenic
1111262489 13:85760395-85760417 ATGGGGAGCCAGAAGGGGTATGG + Intergenic
1114196926 14:20486325-20486347 ATGTGGACACACAAGAAGTAAGG - Intergenic
1114231902 14:20790718-20790740 ATGGGGAGCCAGAAGAGGGAAGG - Intergenic
1114618998 14:24083773-24083795 ATGTGCATCTGTAAGAGGTAGGG - Intronic
1116360347 14:43987845-43987867 ATGTGAACATGGCAGAGGTAAGG - Intergenic
1119162811 14:72467451-72467473 ACATGAACCTAGGAGAGGTAAGG - Intronic
1119702250 14:76762946-76762968 ATGAGGAGCCAGAAGAGGAAGGG + Exonic
1120145456 14:80973914-80973936 ATGTGGAGGCAGAAGAGGTGTGG + Intronic
1125176354 15:36826564-36826586 ATGTGGAGGTAGAAGAGTTCTGG - Intergenic
1125296740 15:38211461-38211483 ATGTGGAGCTAGAGGAGGTAAGG + Intergenic
1125612849 15:40983914-40983936 ATGGAGATCTAGAAGAGGAAGGG + Exonic
1126558145 15:50013301-50013323 ATGTCCCCCTAGAAGAGCTATGG - Intronic
1127027633 15:54824997-54825019 ATGGGGAGCTAGAAGGGGGATGG + Intergenic
1127764801 15:62174506-62174528 ACCTGCACCTAGAAGAGGAATGG - Intergenic
1130927036 15:88393276-88393298 AGTTGAACCTAGAAGAGGTTTGG - Intergenic
1134543992 16:15093832-15093854 ATTTGGACGAAGAAGAGGGAAGG + Intronic
1135361566 16:21819982-21820004 ATTTGGACGAAGAAGAGGGAAGG + Intergenic
1135899135 16:26440197-26440219 ATCTGGACCTTGAAGAACTAAGG - Intergenic
1136260971 16:29075412-29075434 ATTTGGACGAAGAAGAGGGAAGG - Intergenic
1138616765 16:58174192-58174214 ATATGGACCAACAAGAGCTATGG + Intronic
1140339112 16:74139790-74139812 ATGGGGAGCTAGAAGGGGGATGG + Intergenic
1140723590 16:77791967-77791989 ATGTGGCCCTTGAAGAGAGAGGG + Intronic
1143677641 17:8447518-8447540 ATGAGGACCTACAGGAAGTATGG - Intronic
1145016699 17:19403390-19403412 ATGTGAAGCGAGGAGAGGTAAGG - Intergenic
1147114671 17:38290017-38290039 AAGTGGAGCAAGAAGAGGTGAGG + Intergenic
1148414942 17:47499188-47499210 AAGTGGAGCAAGAAGAGGTGAGG - Intergenic
1149570685 17:57670236-57670258 CTGTGGGTCTAGAAAAGGTATGG - Intronic
1151193737 17:72416919-72416941 AAGTGGACCTAGAAGGAGAAAGG - Intergenic
1151597402 17:75087004-75087026 ATGTGGAGTGAGAAGAGGGAGGG + Intergenic
1154109125 18:11550835-11550857 ATGTGGTCGTGGAAGAGGTTAGG - Intergenic
1158188888 18:54803086-54803108 ATGTATATCTAGAAGAGGAAAGG + Intronic
1159861317 18:73652614-73652636 ATGTGGCCAAAGAATAGGTAAGG - Intergenic
1162061244 19:8096810-8096832 ATGGGGACTTAGATGGGGTATGG - Intronic
1162178182 19:8847249-8847271 ATGGGGAGCTAGAAGGGGGATGG + Intergenic
925378675 2:3408051-3408073 ATGTGGAACTAGCAGAGCCAGGG - Intronic
935644115 2:105318891-105318913 ATGTGGCCCTGGAAGTGGAAGGG - Intronic
935804661 2:106733759-106733781 ATTTTGAGCTAGATGAGGTAAGG + Intergenic
937182845 2:120011881-120011903 ATGAAGACCTAGAGGAGGTGTGG - Intergenic
941291867 2:163685631-163685653 ATATTGACCTAGAAGAAGTCTGG - Intronic
941309619 2:163912599-163912621 ATGGGGAGCCAGAAGAGGGATGG - Intergenic
941399484 2:165013112-165013134 ATGTGGACTTAGCTGAGGTTTGG - Intergenic
942001835 2:171655353-171655375 ATCTGGCCCTAGAAAAGGGAAGG - Intergenic
942161134 2:173188717-173188739 ATGATAACCTAGAAGAGGAAAGG - Intronic
942809021 2:179974617-179974639 AAGTAGACTTAGAAGAGTTATGG - Intronic
944080373 2:195781314-195781336 ATGTAGACATAGATGAGATATGG + Intronic
945526610 2:210895652-210895674 ATCTAAACATAGAAGAGGTATGG - Intergenic
945811246 2:214553012-214553034 ATGTGGATACACAAGAGGTATGG - Intronic
948956899 2:241300172-241300194 ATGTGGACCTCGAAGTTGTTTGG - Intronic
1169383591 20:5128823-5128845 TTGTGGACCTAGAAGGTGTGAGG + Intronic
1170423948 20:16219512-16219534 ATGTAGAGCAAGAAGAGGAAAGG + Intergenic
1170818430 20:19735058-19735080 ATGTGGACAGACAAGAGTTATGG + Intergenic
1171205098 20:23272923-23272945 CTGTGAATCTAGAAGAGTTATGG - Intergenic
1172143826 20:32742979-32743001 TTGGGGTCCTAGAAGAGGGACGG - Intronic
1175165826 20:57043824-57043846 AGGTGTGCCTAGAAGAGGTCTGG + Intergenic
1175824600 20:61930171-61930193 AGGTGGACTTAGCAGAGGGAAGG + Intronic
1177356075 21:20009459-20009481 ATTTGGCACTAGAAGAGGGAGGG - Intergenic
1177411085 21:20731494-20731516 ATGTGAACCAAAAAGAGGTAAGG + Intergenic
1180934913 22:19619064-19619086 ATGTGCACCCAGAAGATGTCGGG + Intergenic
1181923322 22:26337861-26337883 ATGAGGAACTACGAGAGGTATGG + Intronic
1184284843 22:43464734-43464756 ATGTGGAGCTACAAGAAGCAAGG - Intronic
949808031 3:7976732-7976754 ATGTGGAGCCAGAAGGGGGATGG - Intergenic
951454376 3:22873991-22874013 CAGAGGACCTAAAAGAGGTATGG + Intergenic
951558067 3:23941242-23941264 ATGAGGACCTAGATGAAGGAGGG - Intronic
953242483 3:41161957-41161979 AGGTGTGCCTAGAAGAGATATGG - Intergenic
955317071 3:57947976-57947998 ATGGGGACCTAGGGGAGGGATGG + Intergenic
956428648 3:69162713-69162735 ATATGAACATAGAAAAGGTAGGG + Intergenic
957155620 3:76540386-76540408 TTGTGAACCTAGTAGTGGTATGG + Intronic
960096885 3:113697437-113697459 ACCTGGATCTAGGAGAGGTAGGG + Intergenic
960611723 3:119560690-119560712 ATGTTGATCTACTAGAGGTAAGG - Intergenic
961602751 3:128073612-128073634 ATGTGGCCCTAGAAGGGATTGGG - Intronic
964046104 3:152329122-152329144 ATGTGGAACTGGAAGTGCTAGGG + Intronic
965710581 3:171552958-171552980 ATGTAGGCCTATAAGAGCTATGG - Intergenic
966657226 3:182373505-182373527 ATGAGGACTTAGGAGAGGGATGG - Intergenic
969250341 4:5964004-5964026 ATGTGCAACTAGAAAAGCTAGGG + Intronic
970073064 4:12184338-12184360 ATGTGGACTTTCAAGAGGTTTGG + Intergenic
970221053 4:13811402-13811424 GTGTGGACCAAGAAGAGAAAAGG - Intergenic
970947101 4:21707528-21707550 ATGTGCACCAGGTAGAGGTAAGG + Intronic
972658330 4:41088585-41088607 ATGAGGCCCTGGAAGAGGGAGGG - Intronic
974303289 4:60098155-60098177 ATGGGGAGCCAGAAGAGGAATGG - Intergenic
976697962 4:87938169-87938191 ATGTGGACCTCTAAGAGAAATGG - Intergenic
978414784 4:108463778-108463800 ATGGGGAGCCAGAAGGGGTATGG - Intergenic
979559198 4:122083162-122083184 ATGTGGAATTAGAAGATCTAGGG + Intergenic
980027902 4:127788415-127788437 ATGTTGCCCTAGAAGGGGGAGGG - Intronic
980970003 4:139558628-139558650 CTCTGGACCTACAAGAGGCAGGG + Intronic
981021437 4:140033404-140033426 AGATGGAGCAAGAAGAGGTACGG + Intronic
983361424 4:166728248-166728270 ATGTGGAACTATTAGAAGTATGG - Intergenic
984320887 4:178194604-178194626 ATGTGGACCTAGACGAAATGTGG - Intergenic
984734392 4:183097618-183097640 AAGGGGTCCTAGAAGAGGAAAGG - Intergenic
987461147 5:18212151-18212173 ATGTAGACCTATAAGAGGAATGG - Intergenic
991353401 5:65743856-65743878 ATGTGGAGGGATAAGAGGTAAGG - Intronic
991651114 5:68854870-68854892 ATGTGCACCTCTAAGAGATAAGG + Intergenic
993045706 5:82863959-82863981 ATGTGGATCTAGAGGAATTAGGG + Intergenic
993118553 5:83746760-83746782 CTGGGGACCTGGAAGTGGTAGGG + Intergenic
993188104 5:84645940-84645962 ATGGGGAGCCAGAAGAGGGATGG - Intergenic
994645291 5:102461119-102461141 TTGTGTACCCGGAAGAGGTAGGG + Intronic
995179346 5:109215723-109215745 ATTTAGACATAGAAAAGGTACGG - Intergenic
996248039 5:121289637-121289659 ATGTGGATCTAGATGATCTAAGG - Intergenic
998167918 5:139855088-139855110 CTCTGGACAGAGAAGAGGTAGGG - Intronic
1000288174 5:159846084-159846106 ATGTGGACCTAGAAGAGTCAGGG - Intergenic
1004465504 6:15881418-15881440 ATGAGGAACTGGAAGAGGCATGG + Intergenic
1005713354 6:28523598-28523620 GTGTGAACCTGGAAGAGGCAGGG + Intronic
1006193440 6:32223137-32223159 AGGAGCACCTAGAAGAGGAAAGG - Intronic
1007399368 6:41595057-41595079 ATGTGTACCCTGGAGAGGTAGGG - Intronic
1009564642 6:65297772-65297794 ATGTGGAGGGAGAAGAGGAAAGG - Intronic
1017018481 6:150120557-150120579 ATGTATACCTAGAAGAGGGACGG + Intergenic
1017370608 6:153701928-153701950 ATGTGGACATAGAAGAGGAAGGG + Intergenic
1018584693 6:165344498-165344520 ATGTGGACCTAGAAGAGGTAAGG - Intronic
1021083054 7:16386147-16386169 ATGGGGAGCTAAAAGAGGGATGG + Intronic
1021576383 7:22109485-22109507 CTGTGGTCCTGGAAGAGCTATGG - Intergenic
1021820707 7:24494928-24494950 ATGGGGAGCTGGAAGGGGTATGG + Intergenic
1022488159 7:30796048-30796070 ATGTGGACATAGTTGAGGGAGGG + Intronic
1023106822 7:36770911-36770933 ATGGAAACCAAGAAGAGGTAGGG - Intergenic
1026248407 7:68644917-68644939 ATGGGGAGCTAGAAGGGGGATGG - Intergenic
1026913407 7:74105964-74105986 ATGTGCCCCTGGACGAGGTACGG + Exonic
1027808292 7:82858972-82858994 ATGTGGAACCACAAGAGATATGG + Intronic
1028233889 7:88337305-88337327 ATCAGCACCTACAAGAGGTAAGG + Intergenic
1036101017 8:5785222-5785244 ATGTGTACCCAGAAGTGGGATGG + Intergenic
1037175889 8:15945438-15945460 ATGGGGAGCTAGAAGGGGGATGG - Intergenic
1038304551 8:26387041-26387063 ATGTGGGCCTTGAAAAGTTAGGG + Intronic
1042532191 8:69827444-69827466 ATGTGGTCGTAGATGAGATACGG - Intronic
1044063161 8:87664355-87664377 ATGTGGACCAGAAAGAGGTCAGG + Intergenic
1049456764 8:142696083-142696105 ATGTGGACCTATGAGAGATCTGG - Intergenic
1056947400 9:91010499-91010521 ACGTGGACCCAGAAGAGCAAGGG - Intergenic
1057146245 9:92761144-92761166 ATGTGGGCACAGGAGAGGTAGGG + Intronic
1060559433 9:124530508-124530530 ATGGGAACCTAGAAGAAGAATGG - Intronic
1061770751 9:132919168-132919190 ATCTGAACCTAGGAAAGGTACGG + Intronic
1061837729 9:133340617-133340639 ATGTGGACTTAGAAGGGGTGAGG - Exonic
1185888995 X:3807864-3807886 ATGTGGACATACAAGAAGTGAGG + Intergenic
1187948616 X:24450643-24450665 TTGTAGACCTAGAAGTGGAATGG - Intergenic
1188291518 X:28394897-28394919 ATGTGGAACCACAAGAGGAAGGG + Intergenic
1188768049 X:34121412-34121434 ATGTGACAGTAGAAGAGGTAGGG - Intergenic
1189161408 X:38813018-38813040 ATGTTGAGGTAGAAGGGGTAGGG + Intergenic
1195481364 X:105349317-105349339 CTGTGGACCTAGAAGATGCTGGG - Intronic
1195771651 X:108357835-108357857 ATGTTGTCCTAGAATAGGGATGG + Intronic