ID: 1018587814

View in Genome Browser
Species Human (GRCh38)
Location 6:165382260-165382282
Sequence CCTTCCAGCCCTTAATCATA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 95}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018587810_1018587814 13 Left 1018587810 6:165382224-165382246 CCCAGGGACTGCCTTGAATAGAT 0: 1
1: 0
2: 1
3: 14
4: 96
Right 1018587814 6:165382260-165382282 CCTTCCAGCCCTTAATCATAAGG 0: 1
1: 0
2: 0
3: 6
4: 95
1018587812_1018587814 2 Left 1018587812 6:165382235-165382257 CCTTGAATAGATGATTCTCAACA 0: 1
1: 1
2: 1
3: 27
4: 224
Right 1018587814 6:165382260-165382282 CCTTCCAGCCCTTAATCATAAGG 0: 1
1: 0
2: 0
3: 6
4: 95
1018587811_1018587814 12 Left 1018587811 6:165382225-165382247 CCAGGGACTGCCTTGAATAGATG 0: 1
1: 0
2: 1
3: 9
4: 113
Right 1018587814 6:165382260-165382282 CCTTCCAGCCCTTAATCATAAGG 0: 1
1: 0
2: 0
3: 6
4: 95

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018587814 Original CRISPR CCTTCCAGCCCTTAATCATA AGG Intronic
901263568 1:7892026-7892048 CCTCCCAGCCCTGAATCTTGAGG - Intergenic
902124092 1:14194052-14194074 CCTTCCAACTCTAAATCAAAGGG + Intergenic
902694749 1:18132806-18132828 CCTGCCATCCCTTAAGCATCTGG + Intronic
909740038 1:79017340-79017362 CCTTTAAGACCATAATCATATGG - Intergenic
911389781 1:97226748-97226770 TCTTCCAGTCCTTGAACATAGGG - Intronic
915364875 1:155309473-155309495 CCTTTCAGCCCCTAATCCTGGGG + Intronic
1071728067 10:88219592-88219614 GCTTCCCTCCCTTAGTCATATGG + Intergenic
1074954103 10:118370611-118370633 CCTCCCAGCCCTTAAACAGGTGG - Intergenic
1079145287 11:17845879-17845901 CCTTCCAGAACTTAATCACCTGG - Intronic
1080268711 11:30427498-30427520 CCATACAGCCATTAAACATAAGG + Intronic
1089645524 11:119876247-119876269 CCTCCCATCCCCTAATCATGAGG + Intergenic
1090034810 11:123239575-123239597 CCTTCCAGGCCTGACTCATCAGG + Intergenic
1092223377 12:6730602-6730624 CCTTCCAGCCCCTGCTCATCTGG - Intronic
1101545750 12:105711079-105711101 CCTTCCAGAACTTTATCCTATGG - Intergenic
1102037019 12:109776532-109776554 CCTTCCACCCCTCAATCCTGGGG + Intergenic
1103421835 12:120791828-120791850 CCTTCTAGGCTTTTATCATAAGG - Intronic
1103572769 12:121856247-121856269 CCTTCCAGCCCTGACTGATGGGG + Intronic
1104438109 12:128772176-128772198 CCATCCAGCCCATAATCAAGAGG - Intergenic
1108064442 13:46563317-46563339 CCTTTCAGCCCTTAGCCAAATGG + Intronic
1108288388 13:48932130-48932152 CCTTCGAGTCCAAAATCATATGG - Intergenic
1114786920 14:25610876-25610898 CCATCCAAACATTAATCATAAGG - Intergenic
1116813105 14:49557970-49557992 CTTTCCAACCCTTAAACTTAGGG - Intergenic
1121959918 14:98249850-98249872 CCTTCAAATCCTTAATGATAGGG + Intergenic
1122588110 14:102825347-102825369 CCTTGCTGCCCTTAATCAGATGG + Intronic
1122790773 14:104183285-104183307 CTTTCCAGCCCCTAATGACAGGG - Intergenic
1130022369 15:80242192-80242214 CCTTCCTGCCTTTCAACATAGGG - Intergenic
1130097606 15:80867636-80867658 CCTGCCAGCCCTTTCTCAGAGGG - Intronic
1133518754 16:6535710-6535732 CCTTCCAGCCCTTGCTCGAAGGG - Intronic
1134347581 16:13405280-13405302 CCTTCATGCCCTTAATTACATGG + Intergenic
1136603876 16:31318126-31318148 CCTACCAAGCCTGAATCATAAGG - Intronic
1141061520 16:80876721-80876743 CCTTCCAGCCCTGAAACACCTGG - Intergenic
1147757504 17:42778783-42778805 TCTTCCACCCCTTACTCCTAAGG + Intronic
1149272708 17:54998615-54998637 CCAACTAGGCCTTAATCATAGGG + Intronic
1150030573 17:61730153-61730175 CTTTCAAGCCTTTAATCCTAGGG + Intronic
1156273095 18:35555281-35555303 CATTCCAGCCCTTTATGCTAAGG - Intergenic
1159027388 18:63196671-63196693 CCGTGCGGCCCTTTATCATACGG + Intronic
1161106436 19:2446024-2446046 CCTTTCACCCCTCAATCACAGGG + Intronic
1167484127 19:49750702-49750724 CCTTCCAGCCATTAAGCAGGGGG - Intronic
928855234 2:35795561-35795583 GCTGCCAGCCCTTCAACATAGGG + Intergenic
929223839 2:39492343-39492365 CCTGTCAGGCTTTAATCATAGGG + Intergenic
929525104 2:42694159-42694181 CTTTCCATCCCTTAAGCAGAAGG + Intronic
930365015 2:50428600-50428622 CCGTCCCGCCTCTAATCATAAGG - Intronic
930773248 2:55148851-55148873 CCTTCCTGCCTTTACTCAAATGG - Intergenic
937070008 2:119056216-119056238 CCTTCAAGCCCTAAATTATGAGG - Intergenic
937933468 2:127223124-127223146 CCTTGCAACTCTTAATTATAAGG + Intergenic
939063721 2:137456751-137456773 CTCTGCAGCCCTTAATTATATGG - Intronic
946268420 2:218568710-218568732 CCTTCCGGTCCTAAATCTTAAGG + Exonic
947590553 2:231382827-231382849 CCTTCCAGCCCTGACTCCTGCGG + Intergenic
1174470212 20:50753912-50753934 CCATCCAGCCCATAGCCATATGG - Intronic
1177590984 21:23167527-23167549 CCTTCTAACTCTTAATCAGAAGG - Intergenic
1179027518 21:37692002-37692024 CATTCCAGCACTTAGTCATTTGG + Intronic
1180676013 22:17587128-17587150 CCTTCCAGCCGTCCATCATCAGG + Exonic
953537322 3:43786316-43786338 CCTGCCAGCCCCTACTAATAGGG + Intergenic
954813793 3:53264726-53264748 CCTTCCAGCTGTTAATCATTGGG + Intergenic
955870527 3:63433684-63433706 CCTTGCAGCCCTGAATCCGAGGG + Intronic
956475330 3:69613415-69613437 TCTTCCAGCCCTGAAACAGATGG + Intergenic
960706870 3:120490501-120490523 CCTTCCAGCATTTTAGCATAAGG - Intergenic
962432858 3:135336120-135336142 CATGCCAGCACTTAAACATAAGG + Intergenic
964598269 3:158463806-158463828 CCTTCCAGCCTTTAACCAATGGG + Intronic
972246988 4:37255683-37255705 GATCCCAGCCCCTAATCATAAGG + Intronic
974150106 4:57995554-57995576 CTGGCCAGTCCTTAATCATATGG + Intergenic
974685150 4:65217414-65217436 CTTTCCAGGCCTTAATCAACTGG + Intergenic
975366927 4:73540387-73540409 CCTTTCAGCCCTTATTCAAATGG - Intergenic
977594530 4:98864429-98864451 CCTTCCTTCCCAAAATCATAAGG + Intergenic
977918217 4:102616550-102616572 CCTTCCTGCCCATAATCATGGGG - Exonic
980265658 4:130512146-130512168 CCTTCCTGCCCTTGAACATTGGG - Intergenic
981403528 4:144341123-144341145 ACTTCCAGCCCTTTGTCATCTGG + Intergenic
985843394 5:2326332-2326354 TCTTCCAGCCCTTAATGAAAGGG + Intergenic
988815913 5:34834893-34834915 CTTTCCATCCCTTACTGATATGG - Intergenic
989172925 5:38491462-38491484 CCTTCAAGGCCTTATTCAGATGG - Intronic
993793575 5:92237465-92237487 CCTTCCAGTGCCTAATCTTAAGG - Intergenic
995659577 5:114465701-114465723 CGTTCCAGCCCTTAAGCTTATGG + Intronic
995985253 5:118163442-118163464 CCTTCCAACCCATAATCCTTAGG + Intergenic
996677988 5:126198562-126198584 CCTTCCAGGCTTTAAACATTTGG - Intergenic
996873681 5:128218026-128218048 CCTTCTACACCTTAATCAAAGGG - Intergenic
997825505 5:137103385-137103407 CTTGCCAGAACTTAATCATAAGG - Intronic
1000702528 5:164470929-164470951 TCTTCCAGCCATTATTCAGATGG + Intergenic
1003039890 6:2677997-2678019 TCTTCCTGCCATTTATCATATGG - Intronic
1003072468 6:2956091-2956113 CCTTCTGGCCTTTAATCAGATGG - Intronic
1007683041 6:43647421-43647443 CCTTTCAGGCCTCATTCATATGG - Intronic
1010189618 6:73181742-73181764 GCTTTGAGCTCTTAATCATAAGG - Intronic
1016806389 6:148216613-148216635 CCGTCCAGCCCTGAATGATGGGG + Intergenic
1018587814 6:165382260-165382282 CCTTCCAGCCCTTAATCATAAGG + Intronic
1023572631 7:41588212-41588234 ACCTCCAGCCCTTAGTCATCAGG - Intergenic
1032292282 7:130599153-130599175 ACTTCCATCCCTTATTCTTAAGG - Intronic
1041461313 8:58114907-58114929 CCTTGCTGCCCTTCATCAGAGGG - Intronic
1041810049 8:61897674-61897696 CTTTACAGCACTTAATCAGAGGG + Intergenic
1043642277 8:82470123-82470145 TCTGCCACCCCTGAATCATAAGG + Intergenic
1045729014 8:105212582-105212604 CTGTGTAGCCCTTAATCATAGGG + Intronic
1045735147 8:105286923-105286945 CCTTCAAGCTCATAAACATAAGG - Intronic
1046095310 8:109552135-109552157 CTTTCCAGAGCTTAGTCATATGG + Intronic
1050879646 9:10683039-10683061 CATTCCAGCCCTGGATCAAAGGG - Intergenic
1051736929 9:20209915-20209937 CCTTCTTGACCTTGATCATAAGG + Intergenic
1051965371 9:22822228-22822250 CCTCCCAGCACTTAGTAATAGGG + Intergenic
1052833408 9:33233433-33233455 CCTTCCACCCCATTATCCTATGG - Intronic
1053274324 9:36771710-36771732 CCATGCAGCCCATACTCATAGGG - Intergenic
1058481653 9:105401988-105402010 CCTCCCACCCCTTCATCATCTGG - Intronic
1186735381 X:12457969-12457991 CCCTCCATCACTTAATGATAAGG + Intronic
1187187329 X:16999579-16999601 CCTTCTAGCCCTAAATTAAATGG + Intronic
1192623556 X:72704458-72704480 CCTGCCAACCTTTAATTATATGG - Intronic
1196534619 X:116828380-116828402 TATTTAAGCCCTTAATCATATGG + Intergenic
1201343186 Y:12955609-12955631 ACATCCAGCCCTTAATAATGGGG + Intergenic