ID: 1018592003

View in Genome Browser
Species Human (GRCh38)
Location 6:165436450-165436472
Sequence GGTTAAATGAACAAGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018591995_1018592003 10 Left 1018591995 6:165436417-165436439 CCCATTAACTTGACTAATAAACC 0: 1
1: 0
2: 0
3: 14
4: 139
Right 1018592003 6:165436450-165436472 GGTTAAATGAACAAGGAGGAAGG No data
1018591996_1018592003 9 Left 1018591996 6:165436418-165436440 CCATTAACTTGACTAATAAACCC 0: 1
1: 0
2: 0
3: 11
4: 114
Right 1018592003 6:165436450-165436472 GGTTAAATGAACAAGGAGGAAGG No data
1018591994_1018592003 11 Left 1018591994 6:165436416-165436438 CCCCATTAACTTGACTAATAAAC 0: 1
1: 0
2: 2
3: 8
4: 186
Right 1018592003 6:165436450-165436472 GGTTAAATGAACAAGGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018592003 Original CRISPR GGTTAAATGAACAAGGAGGA AGG Intronic
No off target data available for this crispr