ID: 1018593032

View in Genome Browser
Species Human (GRCh38)
Location 6:165448453-165448475
Sequence TACTACAGTAAGGCAGCTTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 86
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 83}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018593022_1018593032 16 Left 1018593022 6:165448414-165448436 CCACAGCTGAGAATCCCCATTCC 0: 1
1: 0
2: 3
3: 18
4: 232
Right 1018593032 6:165448453-165448475 TACTACAGTAAGGCAGCTTAGGG 0: 1
1: 0
2: 0
3: 2
4: 83
1018593025_1018593032 1 Left 1018593025 6:165448429-165448451 CCCATTCCTTGACTGGCCTGAGC 0: 1
1: 0
2: 1
3: 16
4: 113
Right 1018593032 6:165448453-165448475 TACTACAGTAAGGCAGCTTAGGG 0: 1
1: 0
2: 0
3: 2
4: 83
1018593027_1018593032 -5 Left 1018593027 6:165448435-165448457 CCTTGACTGGCCTGAGCCTACTA 0: 1
1: 0
2: 1
3: 12
4: 157
Right 1018593032 6:165448453-165448475 TACTACAGTAAGGCAGCTTAGGG 0: 1
1: 0
2: 0
3: 2
4: 83
1018593024_1018593032 2 Left 1018593024 6:165448428-165448450 CCCCATTCCTTGACTGGCCTGAG 0: 1
1: 0
2: 2
3: 19
4: 195
Right 1018593032 6:165448453-165448475 TACTACAGTAAGGCAGCTTAGGG 0: 1
1: 0
2: 0
3: 2
4: 83
1018593026_1018593032 0 Left 1018593026 6:165448430-165448452 CCATTCCTTGACTGGCCTGAGCC 0: 1
1: 0
2: 3
3: 20
4: 198
Right 1018593032 6:165448453-165448475 TACTACAGTAAGGCAGCTTAGGG 0: 1
1: 0
2: 0
3: 2
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018593032 Original CRISPR TACTACAGTAAGGCAGCTTA GGG Intronic
903219556 1:21861570-21861592 TGCTACAGTAAAGCTGCCTAAGG + Intronic
906010841 1:42524011-42524033 AACTATATTAAGGAAGCTTATGG - Intronic
917454688 1:175176304-175176326 TATTGCAGTAAGGTAGCTTTTGG - Intronic
919747898 1:201020116-201020138 GACTAAAGGAAGGAAGCTTAGGG + Intronic
923919848 1:238551393-238551415 TGCTACAGTAAGACAATTTATGG + Intergenic
1065783515 10:29192205-29192227 TTCTACTGGAAGGCAGCTTTGGG + Intergenic
1068246116 10:54371517-54371539 AACTACAGTAAGTCAACTAATGG - Intronic
1069263275 10:66427402-66427424 TCCAACCGTAAGGAAGCTTAGGG - Intronic
1069629983 10:69891725-69891747 TGCTACCGTAAGGCAGCCCATGG + Intronic
1070551028 10:77490955-77490977 TCCTACAGTAGGGCTGATTAGGG - Intronic
1075479697 10:122769238-122769260 TCCTACATTTAGGGAGCTTAGGG - Intergenic
1081694327 11:45099056-45099078 TACTGCAGGAAGCCAGCTGAGGG + Intronic
1085738043 11:79056556-79056578 AACTTCACTAAGGCAGCTTGAGG + Intronic
1087639121 11:100736387-100736409 TATTCCAGGAAGGCAGCTCAGGG - Intronic
1090576217 11:128106688-128106710 TATTCCAGTAAGGCAGGTCAGGG - Intergenic
1092346216 12:7716769-7716791 TACCACAGAATGGCAGCTTGTGG - Intronic
1093954867 12:25204419-25204441 TAGTTCAGTAGGGCAGCTCAGGG - Exonic
1093960135 12:25263573-25263595 AGCTTCAGTAAGGCACCTTAAGG - Intergenic
1095714910 12:45333293-45333315 CACTAAAGTAAAACAGCTTAGGG + Intronic
1101345183 12:103879804-103879826 TCCTGCCTTAAGGCAGCTTATGG - Intergenic
1104287502 12:127438102-127438124 TAATACAGTATGGAAGCTTTTGG + Intergenic
1104369482 12:128210964-128210986 TTCTCCAGGAAAGCAGCTTAAGG + Intergenic
1106006831 13:25778492-25778514 TACTAAATTAAGGCAGCTGCAGG - Intronic
1106069365 13:26393004-26393026 AACTACAGTAAAGCTGCATATGG - Intronic
1107909547 13:45092509-45092531 TACTAAATTAATGTAGCTTAAGG + Intergenic
1117110068 14:52443446-52443468 TAATACAGTAGGGGAGCTCATGG + Intronic
1119014813 14:71039429-71039451 GAGTACAGTTAGGCAGCCTATGG - Intronic
1119804644 14:77474989-77475011 TCCAACAGAAAGGCAGCTTGGGG + Exonic
1124915575 15:33968637-33968659 TTCTACAGAAAGGAAGCTGATGG + Intronic
1126842650 15:52731995-52732017 TACTAAAGCAAGCCACCTTAAGG - Intergenic
1130451274 15:84054813-84054835 AACTACAGGAAGTAAGCTTAAGG - Intergenic
1130622853 15:85482033-85482055 TATTACAGGAAGGCAGTTTTTGG - Intronic
1130708551 15:86256688-86256710 TTCTACATTAAGGCTGTTTACGG + Intronic
1138888318 16:61108590-61108612 TACTACACAGAGGCAGCTTTGGG - Intergenic
1145405398 17:22586012-22586034 TATAGCAGTAAGGCAGGTTATGG + Intergenic
1150094896 17:62365145-62365167 CACTAAAGTAATGGAGCTTATGG + Intergenic
1159128655 18:64255000-64255022 TACTAGAGCATGGCAGCTTTTGG - Intergenic
1160385743 18:78495244-78495266 CACTACTGTAGGGCAGTTTACGG + Intergenic
929041934 2:37753035-37753057 TACTTCATTAAGGCAGCTCTAGG - Intergenic
932243765 2:70179087-70179109 TACTATCCTAAGGCAGATTAAGG + Intronic
934791492 2:97066128-97066150 TACAAAAATAAGGGAGCTTACGG + Intergenic
942364409 2:175208462-175208484 TACAACACTAAGGCAGATTGAGG - Intergenic
942901297 2:181122206-181122228 TACCACATTGAGGCAGCTTTTGG - Intergenic
943121280 2:183739253-183739275 TCCTAGAGAAAGGAAGCTTAGGG - Intergenic
944461453 2:199954798-199954820 GATTACAGTAAGTCAGTTTATGG - Intronic
945247618 2:207733812-207733834 TACTACACTCAGGCAGTTCATGG + Intronic
945445300 2:209930916-209930938 TTCTACAGCATGGCAGCTGAAGG + Intronic
1170799168 20:19576257-19576279 TAATAGAGTAAGGCATCTTTAGG - Intronic
1177940420 21:27403384-27403406 TACTACAGCAAGCTAGCCTAAGG - Intergenic
1181481770 22:23204538-23204560 TCCTACAGGAAGGCTGCTTTGGG - Intronic
1182799056 22:33015577-33015599 TAGTTCAGTAGGGCAGCTCAGGG - Intronic
953931542 3:47008262-47008284 TCCTGCAGGAAGGCAACTTAGGG - Exonic
960933061 3:122874178-122874200 TGCTGCAGTAAGACAGTTTAGGG - Intronic
961376783 3:126472473-126472495 CACCACAGGAAGGCAGCTAATGG + Intronic
962213470 3:133499233-133499255 TACTACTGTAAGACAGTTTTTGG + Intergenic
962828390 3:139119352-139119374 TATTACAGTAAGGGGGCTCATGG - Intronic
963141907 3:141953221-141953243 AAATACGGGAAGGCAGCTTACGG + Intronic
965170143 3:165252368-165252390 TACTTCAATATGGCAGCTTTGGG + Intergenic
967492469 3:190109617-190109639 AGCTACAGTAACTCAGCTTATGG - Intronic
971159543 4:24119995-24120017 TAGTAGAGGAAGGCAGCTAAGGG + Intergenic
974476695 4:62390740-62390762 AACATCAGTAAGGAAGCTTATGG + Intergenic
977422384 4:96818625-96818647 TACTACAGTAGGGAAGTTAAAGG + Intergenic
978639892 4:110857884-110857906 TTCTGCAGTAAGGCTGCTTTGGG + Intergenic
987453602 5:18116587-18116609 TCCTACAGGAAGGCAGCCTAAGG + Intergenic
991091647 5:62699249-62699271 TACAACAGGATGGCAGCTTCTGG - Intergenic
997831115 5:137150865-137150887 TTCTGCAGTATGGCAGCCTATGG + Intronic
1000111899 5:158116100-158116122 TTTTACAGTAAAGCAACTTAAGG + Intergenic
1001028405 5:168243866-168243888 TATAAAAATAAGGCAGCTTATGG - Intronic
1004708312 6:18145315-18145337 TACTACAATATGGCACTTTACGG + Intronic
1007013301 6:38438271-38438293 TACTACTGGATTGCAGCTTATGG + Intronic
1007265617 6:40593654-40593676 CAGGACAGTAAGGCAGCTTTGGG + Intergenic
1007970687 6:46049060-46049082 TACTAGGGTAAGGCAGATTTGGG + Intronic
1009542788 6:64984805-64984827 TGCTACAGTAAGGCTGCTGGAGG - Intronic
1018593032 6:165448453-165448475 TACTACAGTAAGGCAGCTTAGGG + Intronic
1020906945 7:14075162-14075184 ACCTACTGTAAGGCTGCTTAAGG + Intergenic
1029029950 7:97456923-97456945 TCCTAAAGTTAGGTAGCTTATGG - Intergenic
1033935823 7:146584635-146584657 TACTACAACAAGAGAGCTTATGG - Intronic
1036055551 8:5249517-5249539 CACTACAGAAAGGCAGATGATGG + Intergenic
1051447589 9:17156567-17156589 TACTACAATAAGTCAGATTTGGG - Intronic
1052488840 9:29137066-29137088 TACTACAGTACTGCATCTTTGGG - Intergenic
1055803066 9:80061779-80061801 AACTAGAGGAAGGCGGCTTAGGG + Intergenic
1057740186 9:97704480-97704502 TACTACATGAATGCAGCTTAAGG - Intergenic
1058016333 9:100036595-100036617 TATTACAGTAAGGCATATTGCGG - Intronic
1188282018 X:28281879-28281901 TACTTCAGAAGGGCATCTTAAGG + Intergenic
1192374512 X:70545557-70545579 TAAAACTGTAAGGCAGCTTCAGG - Intronic
1201061705 Y:10052066-10052088 TAGGACAGTAAAGCAGCTAAGGG + Intergenic