ID: 1018596551

View in Genome Browser
Species Human (GRCh38)
Location 6:165487254-165487276
Sequence AAACCCTGCTTCACAAAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 291
Summary {0: 7, 1: 30, 2: 30, 3: 30, 4: 194}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018596551_1018596552 20 Left 1018596551 6:165487254-165487276 CCTGTCTTTGTGAAGCAGGGTTT 0: 7
1: 30
2: 30
3: 30
4: 194
Right 1018596552 6:165487297-165487319 AATGAGATTACAGAGTAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018596551 Original CRISPR AAACCCTGCTTCACAAAGAC AGG (reversed) Intronic