ID: 1018599881

View in Genome Browser
Species Human (GRCh38)
Location 6:165527498-165527520
Sequence AGTTATCTGGTGGAGATGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 728
Summary {0: 1, 1: 0, 2: 4, 3: 215, 4: 508}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018599881_1018599890 22 Left 1018599881 6:165527498-165527520 CCTGCCATCTCCACCAGATAACT 0: 1
1: 0
2: 4
3: 215
4: 508
Right 1018599890 6:165527543-165527565 ATTGGCCTGGTACTGGGCTTTGG 0: 1
1: 1
2: 194
3: 195
4: 259
1018599881_1018599887 9 Left 1018599881 6:165527498-165527520 CCTGCCATCTCCACCAGATAACT 0: 1
1: 0
2: 4
3: 215
4: 508
Right 1018599887 6:165527530-165527552 TTGAGAGACAGCTATTGGCCTGG 0: 1
1: 0
2: 3
3: 23
4: 235
1018599881_1018599889 16 Left 1018599881 6:165527498-165527520 CCTGCCATCTCCACCAGATAACT 0: 1
1: 0
2: 4
3: 215
4: 508
Right 1018599889 6:165527537-165527559 ACAGCTATTGGCCTGGTACTGGG 0: 1
1: 2
2: 215
3: 232
4: 283
1018599881_1018599885 4 Left 1018599881 6:165527498-165527520 CCTGCCATCTCCACCAGATAACT 0: 1
1: 0
2: 4
3: 215
4: 508
Right 1018599885 6:165527525-165527547 TCCTTTTGAGAGACAGCTATTGG 0: 3
1: 195
2: 220
3: 170
4: 280
1018599881_1018599891 25 Left 1018599881 6:165527498-165527520 CCTGCCATCTCCACCAGATAACT 0: 1
1: 0
2: 4
3: 215
4: 508
Right 1018599891 6:165527546-165527568 GGCCTGGTACTGGGCTTTGGTGG No data
1018599881_1018599888 15 Left 1018599881 6:165527498-165527520 CCTGCCATCTCCACCAGATAACT 0: 1
1: 0
2: 4
3: 215
4: 508
Right 1018599888 6:165527536-165527558 GACAGCTATTGGCCTGGTACTGG 0: 1
1: 0
2: 196
3: 211
4: 220

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018599881 Original CRISPR AGTTATCTGGTGGAGATGGC AGG (reversed) Intronic
900112905 1:1016205-1016227 AGTTAGCTGGGTGAGGTGGCGGG - Intergenic
901904052 1:12392686-12392708 AGTTATCTGCAGAAGATGGCAGG + Intronic
902415951 1:16239298-16239320 AATTATCTGGCTGTGATGGCAGG + Intergenic
903831482 1:26177816-26177838 AATTATCTGGGGGTGGTGGCAGG + Intronic
904179494 1:28655973-28655995 AGTTATCTGCAGAAGATGGCAGG + Intergenic
904335931 1:29797984-29798006 AGTTATCTGCAGAAGATGGCAGG - Intergenic
905029652 1:34873309-34873331 GGTTATCTGCTGGAGATGTCTGG + Intronic
905068010 1:35200117-35200139 AGTTATCTGGGCGTGGTGGCAGG + Intergenic
905189278 1:36220804-36220826 AATTATCTGGGTGAGGTGGCGGG + Intergenic
905354066 1:37368785-37368807 AGTTATCTGCAGAAGATGGCAGG - Intergenic
905465224 1:38148097-38148119 AGTTATCTGAAGAAGATGGTAGG - Intergenic
906491131 1:46269660-46269682 AGTTTTTTGGTGGGTATGGCAGG - Intronic
907095584 1:51777081-51777103 AGTTATATGGTGGCGATGTTAGG + Intronic
907157450 1:52347526-52347548 AATTATCTGGGGGTGGTGGCGGG - Intronic
907372808 1:54014131-54014153 AGTCACCTGGTGGAGAAGCCAGG + Intronic
907545718 1:55258360-55258382 AGTTTGCTGCTGAAGATGGCTGG + Intergenic
907556498 1:55348863-55348885 AGTGATCTGGTGGAGGTTGGCGG + Intergenic
907597345 1:55732128-55732150 AGTTATCTGCAGAAGATGACAGG - Intergenic
907602084 1:55782149-55782171 AGTTATCTGTAGATGATGGCAGG + Intergenic
909172609 1:72315466-72315488 AATTATCTGCAGAAGATGGCAGG + Intergenic
909576919 1:77185856-77185878 AGTTATCTGCAGAAGATGGCAGG - Intronic
910186730 1:84549514-84549536 TGTTATTTGGTGGTGGTGGCGGG + Intergenic
910370633 1:86512126-86512148 AGTTATCTGCAGAAGATGGCAGG - Intergenic
910561899 1:88599979-88600001 GGTTATCTGCAGAAGATGGCAGG - Intergenic
910588215 1:88901724-88901746 AATTATCTGCAGAAGATGGCAGG - Intergenic
910630219 1:89346250-89346272 AGTTATCTGCAAAAGATGGCAGG - Intergenic
910919231 1:92326346-92326368 CCTGCTCTGGTGGAGATGGCAGG + Intronic
910948213 1:92616686-92616708 AGTTATCTGAAGAAGATGGCAGG - Intronic
911109099 1:94164207-94164229 AGTTATCTTCAGAAGATGGCAGG + Intronic
911257327 1:95647366-95647388 AGTTATCTGCAGAAGATGGCAGG + Intergenic
911738399 1:101361921-101361943 AGTTATCTGCAGAAGATGGCAGG + Intergenic
911980425 1:104559419-104559441 AGTTATCTGCAGAAGATGGCAGG - Intergenic
912129913 1:106588052-106588074 AGTTATCTGCAGAAGATGGCAGG + Intergenic
912212251 1:107568892-107568914 AGTTATCTGCAGAAGATGGCAGG - Intergenic
912252031 1:108021390-108021412 AGTTATCTGCAGAAGATGGCAGG + Intergenic
912733324 1:112128831-112128853 AGTCATCTGCAGAAGATGGCAGG + Intergenic
915501029 1:156317855-156317877 AGTTAGCTGGGGGTGGTGGCAGG - Intronic
916106331 1:161435329-161435351 AGTTATTTGCAGAAGATGGCAGG + Intergenic
916128089 1:161589099-161589121 GGGGCTCTGGTGGAGATGGCAGG - Intronic
916138007 1:161670929-161670951 GGGGCTCTGGTGGAGATGGCAGG - Intronic
917217216 1:172690915-172690937 AGTTATCTGCAGAAGATGGCAGG + Intergenic
917566303 1:176215700-176215722 AGTTAACAAATGGAGATGGCTGG + Intergenic
918155034 1:181836344-181836366 CCTGCTCTGGTGGAGATGGCAGG - Intergenic
918755717 1:188337811-188337833 AGTTATCTGGAGAAGATGGAAGG + Intergenic
918815077 1:189171226-189171248 AGTTACCTGCAGAAGATGGCTGG - Intergenic
918918233 1:190671881-190671903 AGTTATCTGCAGAAGATGGCAGG + Intergenic
919124613 1:193379783-193379805 AGTTATCTACAGAAGATGGCAGG + Intergenic
919317970 1:195999360-195999382 AGTTATCTGCAGAAGATGGCAGG - Intergenic
920197429 1:204238364-204238386 AGTTAGCTGCAGAAGATGGCAGG - Intronic
920437228 1:205955162-205955184 AGTCATCTAGTGTAAATGGCTGG - Intergenic
920441410 1:205983309-205983331 AGTTTGCAGGTGGAGATGGTAGG - Intronic
920777834 1:208957651-208957673 AGTTTTCTGGTGGAGTTGTTAGG - Intergenic
920824898 1:209416067-209416089 ACTTGTCAGGTGGGGATGGCAGG - Intergenic
922255085 1:223886788-223886810 AGTAAACAGGTGGAGATGGGAGG - Intergenic
922781048 1:228252583-228252605 AGTTATCTGCAGAAGATGACAGG + Intronic
923111641 1:230895285-230895307 AGTTATCTTTCGGGGATGGCAGG + Intergenic
923253570 1:232199439-232199461 AGTTATCTGCAGAAGATAGCAGG + Intergenic
923521223 1:234736341-234736363 ATTTGTCGGGTGAAGATGGCAGG - Intergenic
923722448 1:236478733-236478755 AGTTATCTGGGCGTGATGGCGGG - Intronic
924840778 1:247707834-247707856 AGTTATCTGCAGAAGATGGCAGG + Intergenic
924847135 1:247785140-247785162 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1064023707 10:11829692-11829714 GGTTACCTGGTGTAGATGGAGGG - Intronic
1064517644 10:16168258-16168280 AGTTATCTGCAGAAGAGGGCAGG + Intergenic
1064545690 10:16448137-16448159 AGTTATCTGCAGAAGATGGCAGG + Intronic
1065005324 10:21374162-21374184 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1066579410 10:36863603-36863625 AATTATCTGGGCGTGATGGCGGG - Intergenic
1066957621 10:42188051-42188073 AGTTAACTGGAGAAGATGACCGG - Intergenic
1067026695 10:42848356-42848378 AGTTATCTGCTGAGGATGGCAGG + Intergenic
1067125555 10:43512546-43512568 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1067556060 10:47273066-47273088 AATTAGCTGGTCGTGATGGCAGG - Intergenic
1067781785 10:49212988-49213010 TGTTATCTGGTGCAGATGGGAGG + Intergenic
1068007719 10:51409878-51409900 AGTTATCTGCAGAAGATGTCAGG + Intronic
1068129171 10:52876088-52876110 AGTGCCTTGGTGGAGATGGCTGG + Intergenic
1068447208 10:57138591-57138613 AGTTATCTGAAGAAGATGGCAGG - Intergenic
1068556486 10:58464712-58464734 CCTGATCTGGTGGAGGTGGCAGG + Intergenic
1068837218 10:61568380-61568402 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1069583393 10:69580056-69580078 AGTTATCAGGTTGGGAAGGCAGG + Intergenic
1069790833 10:71019585-71019607 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1070030027 10:72668064-72668086 AATTATCTGGTTGTGGTGGCGGG - Intergenic
1071267088 10:83974004-83974026 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1071364470 10:84884523-84884545 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1071937687 10:90549274-90549296 AGTTATCTGCAGAAGATGGAAGG - Intergenic
1071942787 10:90607780-90607802 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1071950802 10:90700939-90700961 AGTTATCTGTGGATGATGGCAGG + Intergenic
1072712544 10:97726042-97726064 AATTAGCTGGTTGTGATGGCAGG + Intergenic
1073314417 10:102568723-102568745 AATTATCTGGGTGAGGTGGCGGG + Intronic
1073656681 10:105424485-105424507 AGTTATCTGCAGAAGATGTCAGG + Intergenic
1073830506 10:107378011-107378033 AGTTATCTGTAGATGATGGCAGG + Intergenic
1073918478 10:108432317-108432339 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1073957686 10:108891655-108891677 AGTTATCTGCAGAAGATGGTAGG + Intergenic
1074252998 10:111772228-111772250 ACTCAGTTGGTGGAGATGGCTGG - Intergenic
1074377644 10:112952235-112952257 AGCTTTCTAGTGGAGATTGCTGG + Intronic
1074479937 10:113810028-113810050 AGGTATCTGGAGTACATGGCAGG + Intergenic
1076772631 10:132674841-132674863 AGTTACCTGCAGAAGATGGCAGG + Intronic
1076927417 10:133499228-133499250 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1076948668 10:133667280-133667302 CGTTCTCTGGTGGCGATGCCCGG - Exonic
1076949652 10:133670579-133670601 CGTTCTCTGGTGGCGATGCCCGG - Intronic
1076950636 10:133673878-133673900 CGTTCTCTGGTGGCGATGCCCGG - Intergenic
1076951626 10:133677188-133677210 CGTTCTCTGGTGGCGATGCCCGG - Intergenic
1076952616 10:133680498-133680520 CGTTCTCTGGTGGCGATGCCCGG - Intergenic
1076953599 10:133683797-133683819 CGTTCTCTGGTGGCGATGCCCGG - Intergenic
1076955572 10:133743459-133743481 CGTTCTCTGGTGGCGATGCCCGG - Intergenic
1076956562 10:133746769-133746791 CGTTCTCTGGTGGCGATGCCCGG - Intergenic
1076957550 10:133750078-133750100 CGTTCTCTGGTGGCGATGCCCGG - Intergenic
1076958534 10:133753377-133753399 CGTTCTCTGGTGGCGATGCCCGG - Intergenic
1076959523 10:133756687-133756709 CGTTCTCTGGTGGCGATGCCCGG - Intergenic
1076960507 10:133759986-133760008 CGTTCTCTGGTGGCGATGCCCGG - Intergenic
1077339732 11:2020952-2020974 AGAGCTCTGGTGGAGCTGGCGGG + Intergenic
1078056206 11:8010935-8010957 AGTTCTCTGCTGCAGAAGGCAGG + Intergenic
1080076590 11:28157493-28157515 AGTTATCTGCAGAAGATGTCAGG - Intronic
1080566282 11:33512569-33512591 AGTTATCTGGGGGTGGTAGCAGG - Intergenic
1080696456 11:34606827-34606849 AGGTATCAGTTGGAGAGGGCTGG + Intergenic
1080976678 11:37350570-37350592 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1081065464 11:38534904-38534926 AGTTGTCTGCAGGAGATGGCAGG + Intergenic
1081110475 11:39128391-39128413 AGTTATCTGCATAAGATGGCAGG - Intergenic
1081609059 11:44547850-44547872 AGTTATCTGTAGAAGATGGCAGG - Intergenic
1082671698 11:56043014-56043036 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1083093143 11:60221099-60221121 AGTTATCTGCAGAAGATGGCAGG - Intronic
1083587800 11:63872982-63873004 AGTGATCTGGAGGAGATTCCGGG + Intronic
1084657064 11:70525810-70525832 AGTTTTGTGGAGGTGATGGCGGG + Intronic
1084829623 11:71759062-71759084 AGTTATCTGGGTGAAGTGGCAGG - Intergenic
1085310720 11:75515147-75515169 TGTGAGCTGGTGGAGATGCCAGG + Intronic
1085685960 11:78622162-78622184 ACTTATCTGCAGAAGATGGCAGG - Intergenic
1085747569 11:79128212-79128234 AGTTATCTGCAGAAGATGCCAGG - Intronic
1085887275 11:80535536-80535558 AGTTAGCTGGGGGTGGTGGCGGG + Intergenic
1086561675 11:88175761-88175783 AGTACTCTGCGGGAGATGGCCGG + Intergenic
1087021607 11:93608755-93608777 AGTTATTTGTTGGTAATGGCAGG + Intergenic
1088191662 11:107234518-107234540 AGTTATCTGCAGAATATGGCAGG + Intergenic
1088449352 11:109965340-109965362 AGTTATCTGTGGAAGATGGCAGG - Intergenic
1088827926 11:113511368-113511390 AATTATCTGGTTGTGGTGGCAGG + Intergenic
1088836653 11:113583361-113583383 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1089274522 11:117325532-117325554 AGTTAGCTGGTTGTGGTGGCAGG - Intronic
1090209495 11:124908075-124908097 AGTCATCTGCAGAAGATGGCAGG + Intergenic
1090221617 11:125031613-125031635 AGTTATCTGCAGAAGATGGCAGG + Intronic
1090756765 11:129798546-129798568 CCTTCTCTGGTGGAGGTGGCAGG - Intergenic
1202822717 11_KI270721v1_random:76141-76163 AGAGCTCTGGTGGAGCTGGCGGG + Intergenic
1092093281 12:5821623-5821645 AGTTATCTGCAGAAGATGGCAGG - Intronic
1092381558 12:8000911-8000933 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1093031873 12:14295977-14295999 AGTTATCTGCGGAAGATGGCAGG + Intergenic
1093036286 12:14335315-14335337 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1093645725 12:21583643-21583665 AGTTATCTGCAGAAGATGGCAGG - Intronic
1093964536 12:25310929-25310951 AGTTATCTGCAGAAGACGGCAGG - Intergenic
1094102526 12:26779235-26779257 AGTTATCTGCAGAAGATGGCAGG - Intronic
1094818825 12:34209526-34209548 TGTTCTCTGGTGGCGATGCCTGG + Intergenic
1094820066 12:34217712-34217734 AGTTAGCTGGGTGTGATGGCAGG + Intergenic
1095527371 12:43143340-43143362 AGTTACCAAGTGGAGAAGGCAGG + Intergenic
1095684884 12:45022450-45022472 AGTTAGCTGGGCGAGGTGGCTGG - Intronic
1095844402 12:46729995-46730017 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1095856243 12:46863702-46863724 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1096095017 12:48928969-48928991 AGTTAGCTGGGCGTGATGGCGGG - Intronic
1096176635 12:49525289-49525311 AGTGAACTGGTGGGGATGGGGGG + Intronic
1096288710 12:50322933-50322955 AGTTATCTACAGAAGATGGCAGG - Intergenic
1096457472 12:51799464-51799486 AGTTATCTGCAGAAGATGGCAGG + Intronic
1096888548 12:54743378-54743400 CCTTTTCTGGTGGAGGTGGCAGG + Intergenic
1097034491 12:56114066-56114088 AGTAATCTGCTGGAGTTGGGTGG + Intergenic
1097098682 12:56570724-56570746 AATTAGCTGGAGGTGATGGCGGG - Intronic
1097437843 12:59572281-59572303 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1097564650 12:61252456-61252478 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1097600593 12:61687647-61687669 AGTTATCTGGCGTAAATGTCAGG + Intergenic
1097821385 12:64132191-64132213 AGTTATCTGCAGAAGAAGGCAGG + Intronic
1098147367 12:67511284-67511306 AGTTATCTGCTGGACATGCATGG - Intergenic
1098523640 12:71461740-71461762 AGTTGAATGGTGGAGGTGGCAGG - Intronic
1098673038 12:73254217-73254239 AGTTAACTGCAGAAGATGGCAGG - Intergenic
1098731049 12:74037321-74037343 AGTTATCTGCAGAAGATAGCAGG - Intergenic
1098733288 12:74065604-74065626 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1098749845 12:74279564-74279586 AGTTATCTGCAGAAGATGACAGG - Intergenic
1098831907 12:75374052-75374074 AGTTATCTGCGGAAGATAGCAGG + Intronic
1099183382 12:79492615-79492637 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1099365921 12:81765357-81765379 AGTTATCTGCAGAATATGGCAGG - Intergenic
1099375646 12:81893930-81893952 AGTAATCTGCAGAAGATGGCAGG - Intergenic
1099526360 12:83723084-83723106 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1099689778 12:85938010-85938032 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1099995069 12:89769557-89769579 AGTTATCTGAAGAGGATGGCAGG + Intergenic
1100083302 12:90878185-90878207 AGTTATCTGCAGAAGATGTCAGG - Intergenic
1100241155 12:92711635-92711657 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1101264129 12:103066095-103066117 AGTTATCTGCAGAAGATGACAGG - Intergenic
1101534670 12:105606131-105606153 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1101543069 12:105682609-105682631 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1103035609 12:117654036-117654058 AGTTATCTGCAGAAGATGGCAGG - Intronic
1105740106 13:23315149-23315171 AGTTATCTTCAGAAGATGGCAGG - Intronic
1106083027 13:26516219-26516241 TGTTATCTGGTTGGGATTGCTGG - Intergenic
1106542913 13:30705858-30705880 AGTCACCTGGAGGAGAGGGCTGG + Intergenic
1107983578 13:45755999-45756021 AGTTATCTGCAGAAGATGACAGG + Intergenic
1108150844 13:47532096-47532118 CCTGCTCTGGTGGAGATGGCAGG - Intergenic
1108302439 13:49092012-49092034 TGTTATCTGCGGAAGATGGCAGG + Intronic
1108904275 13:55449944-55449966 AGTTATTTGCAGAAGATGGCAGG - Intergenic
1108914305 13:55588898-55588920 ACTTATCTGCAGGAGATGGCAGG + Intergenic
1109167425 13:59053289-59053311 AATTAGCTGGTTGAGGTGGCGGG + Intergenic
1109951026 13:69502232-69502254 AGTTATCTGCAGAAGATAGCAGG + Intergenic
1110834138 13:80064656-80064678 TGTTATCTGCAGAAGATGGCAGG + Intergenic
1111317499 13:86581776-86581798 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1111564412 13:89995821-89995843 GGTTTTATGGTGGAGATGTCTGG - Intergenic
1112231129 13:97590191-97590213 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1112249931 13:97770305-97770327 AATTATCTGCAGAAGATGGCAGG + Intergenic
1113319708 13:109221690-109221712 CGTTATCTGCAGAAGATGGCAGG + Intergenic
1113916256 13:113875733-113875755 AGATTTCAGGTGGAGCTGGCTGG - Intergenic
1114205868 14:20570742-20570764 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1115059714 14:29173867-29173889 AGTTATCTGCAGAAGATGACAGG - Intergenic
1115127269 14:30010989-30011011 AGTTATTTTGTGGAGGTGGGAGG - Intronic
1115362968 14:32524328-32524350 AGTTCTGGGGTGGGGATGGCTGG + Intronic
1115503001 14:34065732-34065754 AGTCACCTGGAGGTGATGGCAGG - Intronic
1116058905 14:39896911-39896933 AGTTATCTGTAGAATATGGCAGG - Intergenic
1116068091 14:40009144-40009166 AGTTATCTGAAGAAGATGGGAGG - Intergenic
1116090663 14:40300438-40300460 AGCTATTTGGTAGATATGGCTGG - Intergenic
1116308048 14:43283474-43283496 AGTTATCTGCAGAAGATGGTAGG + Intergenic
1116415069 14:44669285-44669307 AGTTATTTGCAGAAGATGGCAGG - Intergenic
1116531457 14:45978252-45978274 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1117216840 14:53560148-53560170 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1117634130 14:57724346-57724368 AGTTATCTGCAGAAGATGGCAGG - Intronic
1118122436 14:62860197-62860219 AGTTATCTGCAGAAGACGGCAGG + Intronic
1118880777 14:69824045-69824067 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1119097984 14:71851930-71851952 AGTTAGCTGGGTGGGATGGCGGG + Intergenic
1119384929 14:74252092-74252114 TGTTTTCTGGTGGCGATGCCAGG + Intronic
1120082027 14:80227557-80227579 AGTTATCTGCAGAAGATGGCAGG + Intronic
1120169404 14:81233959-81233981 AGTTATCTGCAGAAAATGGCAGG - Intergenic
1120231424 14:81845278-81845300 AGTTATCTGCAGAAGATAGCAGG + Intergenic
1120555997 14:85930472-85930494 AGTTATCTGCATAAGATGGCAGG + Intergenic
1120630597 14:86885384-86885406 AGGTAGCTGCTGGAGTTGGCAGG - Intergenic
1121503421 14:94458396-94458418 CCTGTTCTGGTGGAGATGGCAGG + Intergenic
1122479428 14:102036946-102036968 AATTAGCTGGTTGAGGTGGCTGG + Intronic
1202852458 14_GL000225v1_random:30197-30219 CGTTCTCTGGTGGCGATGTCCGG - Intergenic
1202859632 14_GL000225v1_random:73077-73099 CGTTCTCTGGTGGCGATGCCCGG + Intergenic
1202865550 14_GL000225v1_random:114848-114870 TGTTCTCTGGTGGCGATGCCCGG + Intergenic
1202921853 14_KI270723v1_random:34798-34820 CGTTCTCTGGTGGCGATGCCCGG - Intergenic
1202923061 14_KI270724v1_random:2783-2805 CGTTCTCTGGTGGCGATGCCCGG + Intergenic
1123817817 15:23997529-23997551 AGTTATCTGTGGATGATGGCAGG + Intergenic
1123961374 15:25404937-25404959 AGGAATCTAGTGTAGATGGCAGG - Intronic
1124566291 15:30817092-30817114 AATTAGCTGGTAGCGATGGCAGG - Intergenic
1124908566 15:33895706-33895728 ATTTATCTGGTGGAGTTGGTGGG - Intronic
1125326308 15:38539162-38539184 TGGTATCTGGTGGAAAGGGCAGG - Intronic
1125378076 15:39054821-39054843 AGTTATTTGGAGGAGAAGGGGGG + Intergenic
1125836520 15:42756435-42756457 AATTAGCTGGGGGTGATGGCGGG + Intronic
1126283607 15:46986250-46986272 AGTTGTCTGCAGAAGATGGCAGG - Intergenic
1126534449 15:49746058-49746080 AATTAGCTGGTTGTGATGGCAGG - Intergenic
1127246161 15:57177416-57177438 AGTTATCTGGGTGTGATGGGGGG - Intronic
1127356911 15:58209162-58209184 AGTTATCTGCAGAAGATGGCAGG - Intronic
1128991889 15:72267617-72267639 GGTGATCTGTTGGGGATGGCAGG + Exonic
1129236850 15:74228880-74228902 TGCTCTCTGGTAGAGATGGCGGG + Intergenic
1131724007 15:95202768-95202790 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1131821967 15:96282914-96282936 CTGTATCTGGTGGAGATGCCGGG + Intergenic
1132167413 15:99608750-99608772 AGTTAGCTGGGCGTGATGGCAGG + Intronic
1132834933 16:1948084-1948106 AATTAGCTGGTCGAGGTGGCGGG - Intronic
1133551125 16:6855502-6855524 AATTAGCTGGGGGCGATGGCAGG + Intronic
1133922774 16:10168814-10168836 AGTTAGCTGATGGTGGTGGCAGG + Intronic
1133947204 16:10358760-10358782 AATTAGCTGGTGGTGATGGTGGG - Intronic
1133949734 16:10381000-10381022 AATTATCTGGTTGAGGTGGCAGG - Intronic
1136250938 16:29004564-29004586 AGTTATCTGCAGAAGATGGCGGG - Intergenic
1136265088 16:29111527-29111549 ATTTCCCTGGTGGAGGTGGCTGG + Intergenic
1136488430 16:30588417-30588439 AATTATCTGGGCGAGGTGGCAGG + Intergenic
1138868382 16:60850758-60850780 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1139828524 16:69777447-69777469 AATTATCTGGTCGTGGTGGCAGG - Intronic
1140932568 16:79641187-79641209 AGATAGCTGGTGGAGAGGGTCGG + Intergenic
1140961425 16:79916663-79916685 AGATATATGATGGAGATGACAGG - Intergenic
1141471192 16:84239751-84239773 AGGTTTCTGGTGGAGATGAAGGG + Intergenic
1141559546 16:84858065-84858087 AGTTATCTGCAGAAGATGGCAGG + Intronic
1142053885 16:87979502-87979524 ATTTCCCTGGTGGAGGTGGCTGG + Intronic
1143050019 17:4117497-4117519 AGTTAGCTGGGGGTGGTGGCAGG + Intronic
1146237981 17:31185921-31185943 AGTTATCTGCAGAAGATGGCAGG - Intronic
1146836352 17:36113973-36113995 AGTTATCTGAACAAGATGGCAGG - Intergenic
1146850931 17:36221013-36221035 AGTTATCTGAACTAGATGGCAGG - Intronic
1148924948 17:51075944-51075966 AATTAGCTGGGGGTGATGGCAGG + Intronic
1149082656 17:52677467-52677489 AATTATCCAGTGGTGATGGCGGG + Intergenic
1149438148 17:56651660-56651682 AGTTATCTGGGTGTGGTGGCAGG - Intergenic
1151037814 17:70821615-70821637 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1151899198 17:77000572-77000594 AGTTAGCTGGGTGCGATGGCGGG + Intergenic
1152048710 17:77956635-77956657 AGTTATAAGGTGGTGGTGGCAGG + Intergenic
1152184325 17:78844627-78844649 GGATATTTGGGGGAGATGGCTGG - Intergenic
1153089704 18:1330131-1330153 AGTTAACTGCAGAAGATGGCAGG - Intergenic
1153131278 18:1857740-1857762 GGTTATCTGTAGAAGATGGCAGG + Intergenic
1153217696 18:2835633-2835655 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1154068461 18:11131068-11131090 AGTTATCTGCAGAAGGTGGCAGG - Intronic
1154252674 18:12757306-12757328 AGTTACCTGCAGAAGATGGCAGG + Intergenic
1154506169 18:15042859-15042881 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1155940704 18:31799567-31799589 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1156582549 18:38394433-38394455 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1156606368 18:38671734-38671756 AGTTATCTTCAGAAGATGGCAGG - Intergenic
1156990307 18:43400806-43400828 AGTTATCTGCAGAAGACGGCAGG + Intergenic
1157341198 18:46779996-46780018 AGTTATCTGGAGAAGATGGCAGG - Intergenic
1157441457 18:47715015-47715037 AGACATCTGGTGAAGATTGCAGG + Intergenic
1157597183 18:48871007-48871029 AGAGATCTGGGGGAGATGCCGGG + Intergenic
1157998507 18:52588155-52588177 AGTTATCTGCAGAAGATGGAAGG + Intronic
1158581889 18:58691108-58691130 TCTTCTCTGGAGGAGATGGCGGG - Intronic
1159287787 18:66375451-66375473 AGTTATCTGCAGAAGATAGCAGG - Intergenic
1159375425 18:67586302-67586324 ACTTATCTGGTGAGAATGGCTGG - Intergenic
1159559108 18:69975382-69975404 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1160239101 18:77110320-77110342 AGTTCTCAGGTGCTGATGGCCGG - Intronic
1160421200 18:78746625-78746647 AATTAGCTGGTCGTGATGGCGGG - Intergenic
1164097089 19:22021374-22021396 AGTTATCTGCAGAAAATGGCAGG + Intergenic
1164117261 19:22234605-22234627 AGTTATCTGCAGAAAATGGCAGG + Intergenic
1166553280 19:43681323-43681345 AATTATCTGGTCATGATGGCGGG - Intergenic
1166679967 19:44759923-44759945 AGTTATCTGGTAGAGAGTGGAGG - Exonic
1168539339 19:57197401-57197423 AGTTATCTGCAGAAGATGGCAGG + Intronic
925479118 2:4250829-4250851 TCTGCTCTGGTGGAGATGGCAGG - Intergenic
925716757 2:6791221-6791243 AGTTAGCTGGTTGTGGTGGCGGG + Intergenic
926825569 2:16902261-16902283 GGTTATCTGCAGAAGATGGCAGG + Intergenic
927008714 2:18879693-18879715 ACTTATCTGCAGAAGATGGCAGG - Intergenic
927803782 2:26126403-26126425 AGTTTTCTGGTAGAGATGGGGGG - Intronic
928128572 2:28632637-28632659 AGTTAGCTGGGCGTGATGGCAGG + Intronic
929809575 2:45178473-45178495 AGTCTGCTGGTGGACATGGCTGG + Intergenic
930295407 2:49547540-49547562 AGTTACCTGCAGAAGATGGCAGG + Intergenic
930910148 2:56620868-56620890 AGTTATCTGCAGAAGATGCCAGG - Intergenic
931221218 2:60289770-60289792 AGTTCTTTGGTGGAAAGGGCAGG - Intergenic
931829198 2:66033426-66033448 AGTTATCTGCTGGACAAAGCAGG - Intergenic
933265687 2:80178412-80178434 AGTTATCTGCAGAAGATGACAGG + Intronic
933556465 2:83836556-83836578 AATTAGCTGGGGGTGATGGCGGG + Intergenic
934305739 2:91820565-91820587 AGTTAACTGGAGAAGATGACCGG - Intergenic
934327517 2:92032177-92032199 AGTTAACTGGAGAAGATGACCGG + Intergenic
934465906 2:94262756-94262778 AGTTAACTGGAGAAGATGACCGG + Intergenic
934480442 2:94636142-94636164 AGGAATCTGGTGGAGAAGGACGG - Intergenic
934910318 2:98247144-98247166 AATTAGCTGGGGGAGGTGGCGGG - Intronic
935425113 2:102911356-102911378 AGTTATTTGCAGAAGATGGCAGG + Intergenic
935564312 2:104590282-104590304 AGTTATCTGCAGAAGATGGCAGG + Intergenic
936641221 2:114314661-114314683 AGTTATCTGGACAAGATGGGAGG - Intergenic
937030834 2:118738907-118738929 AGTCCTCTGGTGGAAAAGGCTGG + Intergenic
937785210 2:125887757-125887779 AGTTATCTGCAGAGGATGGCAGG + Intergenic
937800324 2:126074699-126074721 ACTTATCTGAAGAAGATGGCAGG - Intergenic
937852573 2:126648767-126648789 AGCTATCTGCAGGAGATGACAGG + Intergenic
938925273 2:136034562-136034584 ATTTCTCAGGTGGAGAAGGCAGG + Intergenic
939069058 2:137517827-137517849 AGTTATCTGCAGAAGATGGCAGG - Intronic
939213869 2:139212211-139212233 AGTTATCTGCAGAAGATGGCAGG - Intergenic
939633368 2:144551812-144551834 AGTTATCTGCAGATGATGGCAGG + Intergenic
939788688 2:146546142-146546164 AGTTATCTGCAGAAGATGCCAGG + Intergenic
939806237 2:146778445-146778467 AGTTATCTGCAGAAGATGGCAGG - Intergenic
941668014 2:168261101-168261123 AGTTATCTGCAGAAGATGGCAGG - Intergenic
943006893 2:182395812-182395834 AGTTATCTGGAGAAGATGGCAGG - Intronic
943239222 2:185362601-185362623 AGTTATCTGCAGAAGATGGCAGG + Intergenic
943384066 2:187181119-187181141 AGCTATCTGTGGAAGATGGCAGG + Intergenic
943388126 2:187227107-187227129 AGTTATCTGCAGAAGATGGTAGG - Intergenic
943517601 2:188907271-188907293 AGTTATCTGCAGAAGATGGCAGG + Intergenic
945544867 2:211138128-211138150 AGTTATCTGCAGAAGATGGCAGG - Intergenic
945717838 2:213380698-213380720 AGTTATCTGCAGAAGATGGCAGG + Intronic
945725848 2:213471524-213471546 AGTTATCTGCAGAAGATGGCAGG + Intronic
946527871 2:220539996-220540018 AGTTATCTGCAGAAGATGGCAGG + Intergenic
947440718 2:230118695-230118717 AGTTATCTGCAGAAGATGGCAGG + Intergenic
947440843 2:230120228-230120250 AGTTATCTGCAGAAGATGGCAGG - Intergenic
948773813 2:240269683-240269705 AGTGCTCTGATGGAGATGCCAGG + Intergenic
1171089090 20:22267382-22267404 AGTTATCTGGGTGTGGTGGCAGG - Intergenic
1171436116 20:25125919-25125941 AGTCATCTGAGGAAGATGGCAGG - Intergenic
1173028287 20:39330149-39330171 AGTTATCTGTTGTAGATGTATGG + Intergenic
1173152498 20:40579585-40579607 GTTTAGATGGTGGAGATGGCAGG - Intergenic
1174195981 20:48773116-48773138 AATTATCTGGGTGAGGTGGCAGG + Intronic
1174330101 20:49811304-49811326 AGTAATACGGTGGAGGTGGCAGG - Intergenic
1174582772 20:51584171-51584193 AGTGATGTGGTGGGGGTGGCGGG + Intergenic
1174791218 20:53480215-53480237 AATTAGCTGGTGGTGGTGGCAGG - Intronic
1176791684 21:13326165-13326187 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1176998157 21:15580155-15580177 AGTTATCTGCAGAAGACGGCAGG - Intergenic
1177139421 21:17342298-17342320 GGTTATCTGCAGGAGACGGCAGG + Intergenic
1177505564 21:22014211-22014233 AGTTATCTGCAGAAGATGGAAGG + Intergenic
1177913172 21:27056181-27056203 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1177933700 21:27316962-27316984 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1177991074 21:28037167-28037189 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1178012657 21:28305146-28305168 AGTTATCAGCAGAAGATGGCAGG - Intergenic
1178060758 21:28851167-28851189 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1178874727 21:36404890-36404912 AATTATCTGGTTGTGGTGGCAGG - Intronic
1179415153 21:41192550-41192572 AGTTATCTGAAGAAGATGGCAGG + Intronic
1179556017 21:42176706-42176728 AATTATCTGGGCGTGATGGCAGG - Intergenic
1180587041 22:16901929-16901951 AGTTAACTGGAGAAGATGACCGG + Intergenic
1180591150 22:16938396-16938418 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1180845925 22:18982261-18982283 AATTAGCTGGTTGAGGTGGCCGG + Intergenic
1181420650 22:22795802-22795824 AGTTATCTGTAGAGGATGGCAGG - Intronic
1181528178 22:23501938-23501960 AGGTGGCGGGTGGAGATGGCGGG - Intergenic
1181554699 22:23662067-23662089 AGTTATCTGGGCATGATGGCGGG + Intergenic
1181832700 22:25574635-25574657 AGGTATTTGGTGGTGGTGGCGGG + Intronic
1182584160 22:31334126-31334148 AGTTATCCGGGGGAGCTGTCAGG + Intronic
1182596003 22:31421066-31421088 AGTTAGCTGGGTGCGATGGCAGG - Intronic
1184188562 22:42880086-42880108 TGGTAACTGGTGGAGATGGGGGG - Intronic
1184603564 22:45558404-45558426 AGTTATCTGCAGAAGATGGCAGG + Intronic
949125667 3:443175-443197 AGTTATCTGCAGAAGATGGCAGG + Intergenic
949245863 3:1924893-1924915 AGTTATCTGCAGAAGGTGGCGGG - Intergenic
949417595 3:3830912-3830934 AGTTATCTGCAGAAGATGGCAGG + Intronic
949445608 3:4131024-4131046 AGTTATCTGCAGAAGATGGCAGG - Intronic
949638777 3:6012487-6012509 AGTTATCTGCAAAAGATGGCAGG - Intergenic
950006235 3:9692809-9692831 AGTTAGCAGGTGGTGGTGGCTGG - Intronic
951003616 3:17592822-17592844 AGTTATCTACAGAAGATGGCAGG - Intronic
951122567 3:18945537-18945559 AGTTATCTGCAGAAGATGGCAGG - Intergenic
951384522 3:22027505-22027527 AGTTATCTGCAGAAGATGGCAGG - Intronic
951970766 3:28441895-28441917 AGTTATCTGCAGAAGATGGCAGG + Intronic
952605448 3:35142045-35142067 ATTTATCTGCAGAAGATGGCAGG + Intergenic
954054115 3:48007647-48007669 AGTTATCTGTAGAAGATGGCAGG - Intronic
954206066 3:49059864-49059886 AGTTAGCTGGATGTGATGGCAGG - Intronic
955035581 3:55264062-55264084 AGTTATCTGCAGAGGATGGCAGG - Intergenic
956306872 3:67835592-67835614 AGTTATCTGCAGAAGATGGCAGG - Intergenic
956360449 3:68441408-68441430 AGTAATCTGCAGAAGATGGCAGG - Intronic
956509658 3:69980342-69980364 AGTTATCTGCAGAAGATGGCAGG - Intergenic
956703897 3:71982917-71982939 AGTTATCTGCAGAAGATGACAGG + Intergenic
957084724 3:75669060-75669082 CGTTCTCTGGTGGCGATGCCCGG - Intergenic
957247584 3:77733927-77733949 AGTTATCTGCAGAAGATGGCAGG + Intergenic
957754594 3:84469396-84469418 AGTTATCTGCAGAAGATGGCAGG - Intergenic
958480736 3:94643139-94643161 TCTTTTCTGGTGGAGGTGGCAGG + Intergenic
958487681 3:94732504-94732526 AGTTATCTGCAGAAGATGGCAGG + Intergenic
959203655 3:103279275-103279297 AGTTATCTGCAGAAGATGGCAGG + Intergenic
959377348 3:105602864-105602886 AGTTATCTGCGGAAGATGGTAGG + Intergenic
959439506 3:106359152-106359174 AGTTATCTGCAGAAGACGGCAGG - Intergenic
959746017 3:109777303-109777325 AGTTATCTGCAGAAGATGGCAGG + Intergenic
959849374 3:111070497-111070519 GGCTATCTCGTGGAGATGACAGG + Intronic
959997856 3:112698292-112698314 AGTTATCTGCAGAAGATGGAAGG - Intergenic
960115510 3:113888157-113888179 AGTTTTCTTGTGGTGATGTCTGG - Intronic
960494749 3:118360810-118360832 AGTTATCTGAAGATGATGGCAGG + Intergenic
961262845 3:125616393-125616415 AGTTATCTGCAGAAGATGGTAGG - Intergenic
962197727 3:133378345-133378367 AGGTGTCTGATGGAGAAGGCAGG - Intronic
963138718 3:141930616-141930638 AGTTATCTGGGCGTGGTGGCAGG + Intergenic
963368670 3:144369532-144369554 AGTGCTCTGGTGGGGATGGCAGG - Intergenic
963661389 3:148132115-148132137 AGTTATCTGCAGAAGGTGGCAGG - Intergenic
963783902 3:149513679-149513701 AGATATTTGGTGGAGGTGGGGGG + Intergenic
964679249 3:159318944-159318966 AGTTATCTGCAGAAGATGGCAGG + Intronic
965226770 3:166000794-166000816 AGTTATCTGCAGAAGATGGTAGG + Intergenic
965259770 3:166467262-166467284 AGTTATCCTTGGGAGATGGCAGG - Intergenic
965291744 3:166889610-166889632 AGTTATATGCAGAAGATGGCAGG + Intergenic
965668338 3:171120023-171120045 AGTTATTTGGGGGAGAAGGAAGG + Intronic
965708648 3:171534809-171534831 AGTTATCTGCAGAGGATGGCAGG + Intergenic
966044333 3:175530951-175530973 AGTTATCTGCAGAAGATGGCAGG + Intronic
966445690 3:179998529-179998551 AGTTATCTGCAGAAGATGGCAGG - Intronic
966712979 3:182988452-182988474 AATTAGCTGGGTGAGATGGCAGG + Intergenic
967863764 3:194173482-194173504 ATTTATCTGATGGATGTGGCAGG + Intergenic
967893472 3:194379619-194379641 AGTTAACAGGTAGAGGTGGCAGG + Intergenic
968501482 4:952168-952190 AGACATCTGGTGGAGTTGGTTGG + Intronic
968532137 4:1097914-1097936 AGTTACCTGGGCGTGATGGCAGG + Intronic
968800180 4:2738091-2738113 AGTTAGCTGCAGAAGATGGCAGG - Intergenic
968906942 4:3457937-3457959 AGTTATCTGCGGAAGATGGCAGG - Intergenic
970293762 4:14605549-14605571 AGTACCTTGGTGGAGATGGCAGG + Intergenic
971101014 4:23466452-23466474 AGTTATCTGCAGAAGATAGCAGG + Intergenic
971817226 4:31505045-31505067 AGTTATCTGCAGAAGATGGCAGG - Intergenic
971857654 4:32062863-32062885 AGTTATCTGCAGAAGATGACAGG + Intergenic
971979298 4:33732903-33732925 AGTTACCTGCAGAAGATGGCAGG + Intergenic
972201301 4:36717183-36717205 AGTTATCTGTAGAAGATGGCAGG + Intergenic
972759934 4:42093131-42093153 AATTATCTGGTCAAGGTGGCAGG - Intergenic
972882965 4:43448184-43448206 AGTTATCTGCAGAAGATGGCAGG + Intergenic
973102922 4:46294720-46294742 AGTTATCTGCAGAAGATGGCAGG - Intronic
973118436 4:46489013-46489035 AGTTATCTGCAGAAGATGGCAGG - Intergenic
973831509 4:54764543-54764565 ACTGTTCTGGTGGAGGTGGCAGG + Intergenic
974262374 4:59542299-59542321 AGTTATCTGCAGAAGATGGTAGG + Intergenic
974289565 4:59912712-59912734 AGTTAACTGTAGAAGATGGCAGG - Intergenic
974564786 4:63568283-63568305 AGTTATCTCCAGAAGATGGCAGG - Intergenic
974644619 4:64674794-64674816 AATTATCTGCAGGAAATGGCAGG + Intergenic
974746917 4:66088935-66088957 AGTTATCTTCAGAAGATGGCAGG + Intergenic
975024465 4:69531602-69531624 AGTTATCTGCAGAAGATGGCAGG - Intergenic
975386719 4:73767539-73767561 AGTTATCTACAGAAGATGGCAGG + Intergenic
976034208 4:80795851-80795873 AGTTATTTGCAGAAGATGGCAGG + Intronic
977031619 4:91891377-91891399 AGTTATCTACAGAAGATGGCAGG - Intergenic
977204714 4:94155654-94155676 AGTTATCTGCAGAAGATGACAGG - Intergenic
977430763 4:96928182-96928204 AGGTATCTGCAGAAGATGGCAGG - Intergenic
977465998 4:97383344-97383366 AGTTATCTGCAGAAGATGGCAGG - Intronic
977626279 4:99192684-99192706 AGTTATCTGCAGAAGATGGCAGG + Intergenic
977762822 4:100759640-100759662 CGTGCTCTGGTGGAGGTGGCAGG - Intronic
977930415 4:102743849-102743871 AGTTATCTGCAGAAGATGGCAGG + Intronic
978341593 4:107725579-107725601 AGTTATCTGGAGAATATGTCAGG + Intergenic
978772155 4:112467810-112467832 AGTTATCTGCAGAAGATGGCAGG + Intergenic
978818597 4:112937474-112937496 AATTATCTGGAGGTGGTGGCAGG - Intronic
978966848 4:114750914-114750936 AATTATCTGCAGAAGATGGCAGG - Intergenic
979226778 4:118295004-118295026 AGTCATCCCATGGAGATGGCAGG - Exonic
979767017 4:124474565-124474587 AGTTATCTGTAGAAGATGGCAGG - Intergenic
980066923 4:128199935-128199957 AGTTAGCTGGGTGTGATGGCAGG + Intronic
980385790 4:132087061-132087083 AGTTATCTGCAGAAGATGGCAGG + Intergenic
980387950 4:132111211-132111233 AGTTATCTGCAGAATATGGCAGG + Intergenic
980405894 4:132353821-132353843 AGTTATCTGCAGAAGATGGCAGG + Intergenic
980629520 4:135414256-135414278 AGTTATATGCAGAAGATGGCAGG - Intergenic
980957729 4:139445887-139445909 AGTTATCTGCAGAAGATGTCAGG - Intergenic
982597778 4:157407056-157407078 AGTTATCTGCAGAAGATGGCAGG + Intergenic
982623345 4:157732931-157732953 GGTTATCTGCAGAAGATGGCAGG + Intergenic
983027387 4:162755265-162755287 AGTTATCTGCAGAAGATGGCAGG - Intergenic
983102755 4:163645224-163645246 AGTGCTCTGGTGGACATGGATGG - Intronic
983185061 4:164691545-164691567 AGTTATCTGCAGAAGATGGCAGG - Intergenic
983582673 4:169324782-169324804 AGTTATCTGCAGAAGATGGCAGG - Intergenic
984060287 4:174982054-174982076 AGTTATCTGCAGAAGATGGCAGG + Intergenic
984176443 4:176424363-176424385 AGTTATCTCAAAGAGATGGCAGG - Intergenic
984394852 4:179183874-179183896 ATTTAGCTGGGAGAGATGGCAGG + Intergenic
984462407 4:180055097-180055119 AATTATCTGGTCCTGATGGCCGG - Intergenic
984521817 4:180811052-180811074 AGGTGCCTGGTGGAGATGTCCGG + Intergenic
985446250 4:190022514-190022536 CGTTCTCTGGTGGCGATGCCCGG + Intergenic
985452122 4:190068064-190068086 CGTTCTCTGGTGGCGATGCCCGG - Intergenic
985453106 4:190071361-190071383 CGTTCTCTGGTGGCGATGCCCGG - Exonic
985454096 4:190074654-190074676 CGTTCTCTGGTGGCGATGCCCGG - Exonic
985455084 4:190077947-190077969 CGTTCTCTGGTGGCGATGCCCGG - Exonic
985456072 4:190081247-190081269 CGTTCTCTGGTGGCGATGCCCGG - Exonic
985457056 4:190084541-190084563 CGTTCTCTGGTGGCGATGCCCGG - Intergenic
985458043 4:190087834-190087856 CGTTCTCTGGTGGCGATGCCCGG - Exonic
985459032 4:190091134-190091156 CGTTCTCTGGTGGCGATGCCCGG - Exonic
985463285 4:190173903-190173925 CGTTCTCTGGTGGCGATGCCCGG - Exonic
985798613 5:1985437-1985459 AGTTAACCAGTGGAGAGGGCAGG - Intergenic
986573418 5:9188822-9188844 AGTTATCTGGAGGGGATGGGAGG - Intronic
986742916 5:10719476-10719498 AGTTATCTGCAGAAGATGGCAGG - Intronic
986938334 5:12918780-12918802 AGTTACCTGAAGAAGATGGCAGG + Intergenic
986959836 5:13199189-13199211 AGTTAACTGCAGAAGATGGCAGG - Intergenic
987153171 5:15061636-15061658 AGTTATCTGCAGAAGATGGCAGG - Intergenic
987468192 5:18297014-18297036 AGTTATCTGCAGAAGATGGCAGG + Intergenic
987670542 5:21001892-21001914 AATTAGCTGGGCGAGATGGCGGG - Intergenic
988056571 5:26105297-26105319 AGTTATCTGCAGAAGATGGCAGG + Intergenic
988107755 5:26772517-26772539 AGTTATCTGCAGAAGATGGCAGG - Intergenic
988188771 5:27901207-27901229 GGTTATCTGCAGAAGATGGCAGG - Intergenic
988562127 5:32290818-32290840 CGTTATCTGCAGAAGATGGCAGG - Intronic
988766410 5:34382267-34382289 AGTTATCTGCAAAAGATGGCAGG - Intergenic
989097828 5:37797291-37797313 AGTTATCTGCAGAAGATGGCAGG - Intergenic
989307506 5:39974650-39974672 AGCTATCTGAAGAAGATGGCAGG + Intergenic
989457647 5:41661797-41661819 AGTTATCTGCAGAAGATGGCGGG + Intergenic
989486387 5:41996388-41996410 AGTTATCTGCAAAAGATGGCAGG + Intergenic
990903114 5:60774739-60774761 AGTTTTATGGTGGAGTTGGTAGG - Intronic
991013809 5:61910929-61910951 AGTTATCTGCAGAAGATAGCAGG + Intergenic
991033542 5:62105893-62105915 AGTTATCTGCAGAAAATGGCAGG - Intergenic
991214762 5:64149235-64149257 CCTTCTCTGGTGGAGGTGGCAGG + Intergenic
991596746 5:68314385-68314407 GGTTATCAGGTGGAGTTTGCTGG + Intergenic
991946143 5:71900111-71900133 AGTTATCTGCAGAAGATGGCAGG - Intergenic
992109883 5:73482906-73482928 AGTTATCTGCAGAAGATGACAGG + Intergenic
992169527 5:74087950-74087972 AATTATCTGGGCGAGGTGGCAGG - Intergenic
992242936 5:74789722-74789744 AGTTATCTGAAGAAGATGGCAGG - Intronic
992242952 5:74789838-74789860 AGTTATCTGCAGAAGATGGCAGG - Intronic
992380398 5:76230638-76230660 AATTATCTGGGCGTGATGGCGGG + Intronic
992654539 5:78895525-78895547 AGGTATCAGGTGAAGAAGGCAGG - Intronic
993367471 5:87050985-87051007 AGTTATCTGCAGAAGATGGCAGG + Intergenic
993412585 5:87591841-87591863 AGTTATCTGCAGAAGATGGTAGG + Intergenic
993780691 5:92062365-92062387 AGTTATCTGCAGAAGATGGCAGG - Intergenic
993791788 5:92218882-92218904 ATTTATCTGCAGAAGATGGCAGG - Intergenic
994855438 5:105113613-105113635 AGTTATCTGCAGAAGATGGCAGG + Intergenic
994984423 5:106915762-106915784 AGTTATCTGCAGAAGATGGCAGG + Intergenic
995427736 5:112043755-112043777 AGTTATTTGCAGAAGATGGCAGG + Intergenic
996018556 5:118567827-118567849 AGTTATCTGCAGAAGGTGGCAGG - Intergenic
996392205 5:122973814-122973836 AGTTATCTGCAGATGATGGCAGG + Intronic
996825560 5:127677806-127677828 AATTATCTGCAGAAGATGGCAGG - Intergenic
996912226 5:128668945-128668967 AATTATCTGTGGGTGATGGCAGG - Intronic
997702830 5:135916363-135916385 AGTTATATGCTGAAGATGGTTGG + Intergenic
999388297 5:151171330-151171352 AATTAGCTGGGCGAGATGGCGGG + Intergenic
1000223249 5:159234277-159234299 AGGTATCTGCAGAAGATGGCAGG + Intergenic
1000264553 5:159622003-159622025 CCTTCTCTGGTGGAGGTGGCCGG - Intergenic
1000416970 5:160993873-160993895 AGTTATCTACAGAAGATGGCAGG - Intergenic
1001173592 5:169444614-169444636 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1001279398 5:170375644-170375666 AGTTCTGTGGTTGAGATGCCAGG + Exonic
1001908922 5:175497779-175497801 AGTTAGCTGGGTGAGGTGGCGGG + Intronic
1002997963 6:2304718-2304740 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1003695901 6:8406168-8406190 AGTCATCTGCAGAAGATGGCAGG + Intergenic
1005185165 6:23157044-23157066 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1005493052 6:26364306-26364328 TGGTATCTGCTTGAGATGGCTGG - Intergenic
1005502304 6:26439630-26439652 CAGTATCTGGTTGAGATGGCTGG - Intergenic
1005895468 6:30173549-30173571 AATTAGCTGGGCGAGATGGCAGG + Intergenic
1005942240 6:30569232-30569254 AGTTAGCTGGGCGAGGTGGCGGG - Intergenic
1006001553 6:30969047-30969069 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1006062349 6:31433194-31433216 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1006921544 6:37630806-37630828 GGTGCTTTGGTGGAGATGGCTGG + Exonic
1007369793 6:41419055-41419077 AGGTAACTGGTGGTGATGGTGGG - Intergenic
1008079360 6:47178414-47178436 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1008266925 6:49439317-49439339 AGTTATCTGCAGAAGATGGCAGG + Intronic
1008400289 6:51055443-51055465 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1008820395 6:55625124-55625146 AGTTATCTGCAGAAGACGGCTGG - Intergenic
1008868032 6:56238657-56238679 AGGTATCTGCTGAAGGTGGCAGG - Intronic
1009169504 6:60381319-60381341 AGTTTTCTGGTGGTGTTGGTTGG + Intergenic
1009308634 6:62122274-62122296 GGTTATCTGCAGAAGATGGCAGG - Intronic
1009390114 6:63135106-63135128 AGTTATCTGCAGAAGATGACAGG + Intergenic
1009806492 6:68606924-68606946 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1009851928 6:69208986-69209008 AGTTATCTGCAGAAGATGGCAGG + Intronic
1010768364 6:79801543-79801565 AGTCATGTGCTGCAGATGGCAGG + Intergenic
1011039347 6:83013302-83013324 AGTTATCTGCAGAAGATGGCAGG + Intronic
1011069098 6:83361637-83361659 ATTTATCTGCAGAAGATGGCAGG - Intronic
1012272848 6:97236178-97236200 AATTAGCTGGACGAGATGGCAGG + Intronic
1012344585 6:98170291-98170313 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1012730458 6:102874291-102874313 AGTTATCTGTAGAAGATGGCAGG - Intergenic
1012737883 6:102973996-102974018 CTTGTTCTGGTGGAGATGGCAGG - Intergenic
1012820800 6:104082890-104082912 AGTTATCTGCAGAAGATGGCCGG - Intergenic
1012920797 6:105219573-105219595 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1013086417 6:106861599-106861621 AATTATCTGGGTGAGGTGGCAGG - Intergenic
1013406668 6:109849774-109849796 AGTTATCTGTAGAAGATGGCAGG - Intergenic
1014363402 6:120508382-120508404 AGTTATCTGAAAAAGATGGCAGG + Intergenic
1014534200 6:122596658-122596680 AGTTATCTGCAGAAGATGGCAGG + Intronic
1014631638 6:123796773-123796795 AGTTGTCTGCAGAAGATGGCAGG - Intergenic
1014932848 6:127354304-127354326 AGTTATTTGGTGGAGTTGTTAGG - Intergenic
1015095453 6:129409629-129409651 AGTGATCTGCAGAAGATGGCAGG + Intronic
1015443289 6:133272593-133272615 AGTTATCTGTAGAAGATGGTTGG + Intronic
1015475746 6:133657463-133657485 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1015862089 6:137691813-137691835 AGTTATCTGTGGATGATGGCAGG - Intergenic
1016144287 6:140649374-140649396 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1016459527 6:144267577-144267599 AATTATCTGGTTGTGGTGGCAGG + Intergenic
1016735341 6:147472445-147472467 AGTTACCTGGTTGTGGTGGCAGG - Intergenic
1016940418 6:149478800-149478822 AGGTATGGGGTGAAGATGGCAGG - Intronic
1017227809 6:152041120-152041142 AGTTATCTGCAGGAGATGCAGGG + Intronic
1017826673 6:158086838-158086860 CGTCATCTGGAGGACATGGCGGG - Exonic
1017885827 6:158598820-158598842 AATTATCTGGGCGTGATGGCGGG - Intronic
1017977121 6:159368085-159368107 AGTTATCTGCAGAAGATGGCTGG + Intergenic
1018599881 6:165527498-165527520 AGTTATCTGGTGGAGATGGCAGG - Intronic
1018771288 6:166973462-166973484 AATTAGCTGGGTGAGATGGCGGG + Intergenic
1018803795 6:167243019-167243041 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1019662991 7:2235732-2235754 AGACACATGGTGGAGATGGCGGG + Intronic
1019843567 7:3474388-3474410 AAACATCTGGTAGAGATGGCCGG - Intronic
1020673348 7:11147866-11147888 AGTTATCTAGTGGGAATGTCAGG - Intronic
1020710346 7:11597597-11597619 AGTTATCTGCAGAAGATGGCAGG - Intronic
1022006668 7:26271916-26271938 AATTAGCTGGGGGAGGTGGCGGG + Intergenic
1022185750 7:27966676-27966698 ATTTCTCTGGTGGAAAAGGCAGG + Intronic
1024040534 7:45550116-45550138 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1026046492 7:66909127-66909149 AGTTATATGCAGAAGATGGCAGG + Intergenic
1026314613 7:69217351-69217373 AGTCATCTGGAAGAGGTGGCGGG - Intergenic
1026688551 7:72533301-72533323 AATTAGCTGGGGGTGATGGCAGG - Intergenic
1026723784 7:72855198-72855220 AATTAGCTGGGGGTGATGGCAGG - Intergenic
1027357831 7:77376626-77376648 AATTATCTGGTCGTGGTGGCGGG + Intronic
1027685793 7:81277926-81277948 AGTTATCTGCAGAAAATGGCAGG - Intergenic
1027771773 7:82416064-82416086 AATTAGCTGGTCGTGATGGCGGG + Intronic
1027963806 7:84980729-84980751 ACTGTTCTGGTGGAGGTGGCAGG + Intergenic
1028141732 7:87281955-87281977 AGTTATCTTCAGAAGATGGCAGG - Intergenic
1028935010 7:96455034-96455056 AATTATCTGCAGAAGATGGCAGG - Intergenic
1029056116 7:97744586-97744608 AGTTAGCTGGGGGAGAAGGAAGG + Intergenic
1030058896 7:105607414-105607436 AGGAATCGGGTGGAGATGACAGG + Exonic
1030059393 7:105610886-105610908 AGGCATCTGGTGGAGATGCCTGG + Intronic
1030221859 7:107106581-107106603 AGGTAGCTGATGGAGATGGAGGG - Intronic
1030277455 7:107736085-107736107 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1030368750 7:108673998-108674020 AGTTTTCTGCAGAAGATGGCAGG - Intergenic
1030931292 7:115525712-115525734 AGTTATCTGCGGAAGATGGCAGG + Intergenic
1031236824 7:119187986-119188008 AGTTATCTGCAGAAGATGACAGG - Intergenic
1031676555 7:124618320-124618342 AGTTATCTGCAGAAAATGGCAGG - Intergenic
1032153107 7:129446987-129447009 AGTTATCTGCAGAAGATGGCAGG + Intronic
1034864492 7:154629371-154629393 AGTTATCTGCATGAGATGTCAGG - Intronic
1035333608 7:158112201-158112223 AGTTCTCTGGAGGAGACAGCTGG + Intronic
1037364596 8:18108298-18108320 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1038995771 8:32921274-32921296 AGCTCTGTGGTGGAGATGGAAGG + Intergenic
1039044159 8:33434863-33434885 TGTTATCTGGTGGCAGTGGCAGG - Intronic
1039499578 8:38005926-38005948 AATTAGCTGGGGGTGATGGCGGG - Intergenic
1040911943 8:52528388-52528410 TGTTATCTGCAGAAGATGGCAGG - Intergenic
1041194610 8:55388252-55388274 AATTATCTTGTTGAGATGCCAGG - Intronic
1041246908 8:55896886-55896908 AATTAGCTGGGGGTGATGGCGGG - Intronic
1041934551 8:63321300-63321322 AGTTATCTGCAGAAGATGACAGG - Intergenic
1042001067 8:64124026-64124048 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1042085615 8:65105668-65105690 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1044150798 8:88773045-88773067 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1044285975 8:90412476-90412498 AGTTATCTGCAGAAGATGGTAGG + Intergenic
1044801536 8:95962179-95962201 AGTTACCTGGGCGTGATGGCAGG - Intergenic
1045221835 8:100207037-100207059 AGTTATCTGCAGAAGATGGCAGG - Intronic
1046063987 8:109175192-109175214 GGTTATCTGCAGAAGATGGCAGG + Intergenic
1046417642 8:113937824-113937846 AGTTGTCTGAAGAAGATGGCAGG + Intergenic
1046585788 8:116147749-116147771 AGTTATTTGCAGAAGATGGCAGG + Intergenic
1047303956 8:123638284-123638306 AGTTAGCTGGTGGAGATAAAAGG + Intergenic
1049028136 8:140011824-140011846 AATTAGCTGGGTGAGATGGCAGG - Intronic
1050052633 9:1619166-1619188 AGTGATCTGGCTGAGATGTCTGG - Intergenic
1050482671 9:6102573-6102595 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1050888738 9:10796784-10796806 AGTTATCTGCAGAAGATGGTAGG + Intergenic
1051882143 9:21850632-21850654 AGTTATCTGCAGAAGATGGCAGG - Intronic
1051966460 9:22834547-22834569 AGTTACCTGCAGAAGATGGCAGG - Intergenic
1052442272 9:28512312-28512334 AGTTATCTGCAGAAGATGACAGG + Intronic
1053614481 9:39749393-39749415 AGTTATCTGGTGATGCTGGTGGG + Intergenic
1053677399 9:40447792-40447814 AGGAATCTGGTGGAGAAGGACGG + Intergenic
1053695960 9:40639533-40639555 AGTTAACTGGAGAAGATGACCGG + Intergenic
1053872514 9:42507331-42507353 AGTTATCTGGTGATGCTGGTGGG + Intergenic
1053927154 9:43073946-43073968 AGGAATCTGGTGGAGAAGGACGG + Intergenic
1054239037 9:62592999-62593021 AGTTATCTGGTGATGCTGGTGGG - Intergenic
1054261397 9:62869011-62869033 AGTTATCTGGTGATGCTGGTGGG + Intergenic
1054286318 9:63177120-63177142 AGGAATCTGGTGGAGAAGGACGG - Intergenic
1054290472 9:63283319-63283341 AGGAATCTGGTGGAGAAGGACGG + Intergenic
1054307207 9:63438751-63438773 AGTTAACTGGAGAAGATGACCGG + Intergenic
1054388497 9:64587860-64587882 AGGAATCTGGTGGAGAAGGACGG + Intergenic
1054405940 9:64762743-64762765 AGTTAACTGGAGAAGATGACCGG + Intergenic
1054439566 9:65248230-65248252 AGTTAACTGGAGAAGATGACCGG + Intergenic
1054490841 9:65773709-65773731 AGTTAACTGGAGAAGATGACCGG - Intergenic
1054507223 9:65928503-65928525 AGGAATCTGGTGGAGAAGGACGG - Intergenic
1054553166 9:66627521-66627543 AGTTATCTGGTGATGCTGGTGGG - Intergenic
1055110656 9:72556263-72556285 AATTATCTGGGTGTGATGGCAGG - Intronic
1055524304 9:77115039-77115061 GGTGCTTTGGTGGAGATGGCTGG + Intergenic
1055903944 9:81271234-81271256 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1056156662 9:83845179-83845201 AGTTAGCTGCAGAAGATGGCGGG - Intronic
1056314237 9:85372975-85372997 AATTATCTGCTGAAGATGGCAGG + Intergenic
1056353876 9:85778348-85778370 AGTTATCTGCAGAAGATGGCGGG + Intergenic
1057150529 9:92792339-92792361 GGTGATCTGGGGAAGATGGCCGG + Intergenic
1057150757 9:92794051-92794073 AATTATCTGGGCGTGATGGCGGG - Intergenic
1057208304 9:93185827-93185849 AGTCAGCTGGTGGCGAGGGCAGG + Intronic
1058019893 9:100076050-100076072 AGTTATCTGCAGAAGATGGCAGG - Intronic
1058259260 9:102809698-102809720 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1059196508 9:112375898-112375920 AGTTATCTGCAGAAGAAGGCAGG + Intergenic
1059960170 9:119556833-119556855 ATTTATTTGGTGGCGGTGGCGGG - Intergenic
1060903727 9:127285706-127285728 AGTTATATTTTGGAGATGGGTGG + Intronic
1062135467 9:134924993-134925015 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1202778407 9_KI270717v1_random:13146-13168 AGTTAACTGGAGAAGATGACCGG + Intergenic
1203738790 Un_GL000216v2:161310-161332 CGTTCTCTGGTGGCGATGCCCGG - Intergenic
1186279492 X:7977088-7977110 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1186384097 X:9091792-9091814 AGTTATCTGCAGAAGATGGCAGG + Intronic
1186469770 X:9812139-9812161 AGTTGTCTGCAGAAGATGGCAGG + Intronic
1186720172 X:12295853-12295875 TGTTATTTAGTGGAGAGGGCTGG + Intronic
1187604862 X:20871832-20871854 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1188252571 X:27915787-27915809 AGTTCTCTCGTGGAGATGCGTGG - Intergenic
1188442439 X:30225956-30225978 AATTATCTGGTCGTGGTGGCAGG - Intergenic
1188722837 X:33544159-33544181 AGTGCTCAGGTGGAAATGGCAGG - Intergenic
1188817112 X:34729211-34729233 GATTATCTGGTGGTGGTGGCGGG - Intergenic
1189154887 X:38746752-38746774 AGTTATTTGCAGAAGATGGCAGG + Intergenic
1189170130 X:38901122-38901144 AATTATCTGGGCGTGATGGCGGG - Intergenic
1189710650 X:43808367-43808389 AGTCATCTGGTGGTGATTTCTGG - Intronic
1190996751 X:55617499-55617521 AGTTATCTACAGAAGATGGCAGG + Intergenic
1191095709 X:56671205-56671227 AGTTATCTGTGGAAGATAGCAGG + Intergenic
1191658808 X:63629837-63629859 AGTTATCTGCTGAAGATGGCAGG + Intergenic
1191719244 X:64215740-64215762 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1191759358 X:64629893-64629915 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1191941263 X:66483896-66483918 AGTTATCTGCAGAAGATGACAGG + Intergenic
1192297714 X:69868047-69868069 AGTTATCTGCAGAAGATGGCAGG + Intronic
1192898700 X:75471878-75471900 AGTTATCTGCAGAAGATGGCAGG - Intronic
1192996189 X:76515546-76515568 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1193053487 X:77125736-77125758 AGTTTTCTGCAGAAGATGGCAGG - Intergenic
1193447152 X:81618739-81618761 AGTTATCTGCAGGAGATGGCAGG - Intergenic
1193832946 X:86310065-86310087 AGTTATCTGCAGAAGATGACAGG - Intronic
1193904483 X:87225799-87225821 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1193957280 X:87878178-87878200 AGTTATCTGCAGAAGGTGGCAGG - Intergenic
1194179594 X:90695967-90695989 AGTTATCTGAAGAAGATGGCAGG + Intergenic
1194210275 X:91062322-91062344 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1194439014 X:93906315-93906337 CCTGATCTGGTGGAGGTGGCAGG + Intergenic
1194443546 X:93961071-93961093 AGTTATCTGCAGAAGATGGAAGG - Intergenic
1194513420 X:94822284-94822306 AGTTATCTGCAGAAGATGACAGG + Intergenic
1194849249 X:98852206-98852228 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1195162676 X:102185724-102185746 AGTAATCTGGTGGAGGAGGGGGG + Intergenic
1195228465 X:102822239-102822261 AGTTATCTAGGAAAGATGGCAGG - Intergenic
1196135972 X:112209875-112209897 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1196381502 X:115095959-115095981 AGTTTTCTGGTGGAGATTTTAGG - Intergenic
1196689553 X:118544807-118544829 AATTAACTGGGGGTGATGGCGGG - Intronic
1197002284 X:121452889-121452911 AGTTATCTGCAGAAGATGACAGG - Intergenic
1197097464 X:122612806-122612828 AGTTATCTGCAGAAGATGGTAGG - Intergenic
1197245049 X:124159026-124159048 AGTTATCTGCAGAAGATGGCAGG + Intronic
1197372060 X:125637898-125637920 AGTTACCTGCAGAAGATGGCAGG + Intergenic
1197380003 X:125727937-125727959 AGTTTTCTGCAGAAGATGGCAGG + Intergenic
1197409326 X:126096447-126096469 AGTTATATGCAGAAGATGGCAGG + Intergenic
1197591864 X:128419355-128419377 AGTTATCTGCAGAAGATGACTGG - Intergenic
1198169999 X:134096222-134096244 AGTTATCTGTGGAGGATGGCAGG - Intergenic
1198177129 X:134167668-134167690 AGTTCTCTGGTGGTGGCGGCTGG - Intergenic
1199024376 X:142919687-142919709 ACTTATCTGCAGAAGATGGCAGG - Intergenic
1199040588 X:143111068-143111090 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1199460393 X:148077435-148077457 AGATAACTGCTGGAGATGTCAGG - Intergenic
1199671305 X:150150627-150150649 GCTTATGTGGTGGAGAGGGCTGG - Intergenic
1200340497 X:155390672-155390694 AGTTATCTGCAGAAGATGACAGG + Intergenic
1200526256 Y:4278136-4278158 AGTTATCTGAAGAAGATGGCAGG + Intergenic
1200528116 Y:4298000-4298022 CCTGCTCTGGTGGAGATGGCAGG - Intergenic
1201175621 Y:11307047-11307069 CGTTTTCTGGTGGCGATGCCCGG - Intergenic
1201179586 Y:11332460-11332482 CGTTCTCTGGTGGCGATGCCCGG - Intergenic
1201193721 Y:11471449-11471471 AGTTAACTGGAGAAGATGACAGG + Intergenic
1201796633 Y:17903443-17903465 AGTTATCTGCAGAAAATGGCAGG + Intergenic
1201798423 Y:17926667-17926689 GGTTATCTGCAGAAGATGGCAGG - Intergenic
1201803130 Y:17979290-17979312 GGTTATCTGCAGAAGATGGCAGG + Intergenic
1201804922 Y:18002542-18002564 AGTTATCTGCAGAAAATGGCAGG - Intergenic
1202358017 Y:24072505-24072527 AGTTATCTGCAGAAAATGGCAGG + Intergenic
1202359743 Y:24095357-24095379 GGTTATCTGCAGAAGATGGCAGG - Intergenic
1202511035 Y:25574757-25574779 GGTTATCTGCAGAAGATGGCAGG + Intergenic
1202512761 Y:25597608-25597630 AGTTATCTGCAGAAAATGGCAGG - Intergenic