ID: 1018600295

View in Genome Browser
Species Human (GRCh38)
Location 6:165531011-165531033
Sequence TCCCATGTAGAGGAGGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 397
Summary {0: 1, 1: 0, 2: 1, 3: 34, 4: 361}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018600295 Original CRISPR TCCCATGTAGAGGAGGAGGA TGG (reversed) Intronic
900032002 1:379073-379095 TTCCATAAAGAGGAGGATGAGGG + Intergenic
900052551 1:607259-607281 TTCCATAAAGAGGAGGATGAGGG + Intergenic
900714739 1:4137031-4137053 TCCCATGTAGAAAGGTAGGAGGG - Intergenic
901264652 1:7901400-7901422 TGCCTTGGAGAGGAGGTGGAAGG + Intergenic
901460901 1:9391057-9391079 TCCCATGCTGAGGAGGGGTAAGG - Intergenic
901518780 1:9767661-9767683 CACCATGTTGAGGAGGAGGGTGG - Intronic
902573834 1:17364201-17364223 TTCCAAGAAGAGGAGGAGGAGGG + Intergenic
902922087 1:19672131-19672153 TGCCAGGAAGAGGAGGAGGCTGG - Intronic
903043429 1:20549240-20549262 TTCCATGGAGGGGAGGGGGATGG - Intergenic
903229748 1:21914558-21914580 TCCCATGGGGAGGAGCAGAAAGG + Intronic
903259691 1:22124721-22124743 TCCCAGATACAGGAGAAGGAAGG + Intronic
903285150 1:22272526-22272548 TTCCAGGCAGAGGAGGAGCACGG + Intergenic
903605140 1:24570059-24570081 TCCCATCTAGAGGTTGAGGTGGG - Intronic
906050967 1:42871618-42871640 TTCTATGTAGAGGAAGAAGAAGG + Intergenic
906150758 1:43586205-43586227 TCCCATGAAGAGGAGGAGACAGG + Intronic
907046006 1:51300369-51300391 CTCCATGCAGAGGAGGGGGAGGG + Intronic
907704993 1:56825296-56825318 TGGCATGTGGAAGAGGAGGAGGG + Intergenic
908632943 1:66130467-66130489 TCCCATGTAGTGGATGCTGAGGG + Intronic
908787428 1:67749036-67749058 TCCCCTGGAGGGGAGGAGGTGGG + Intronic
909878490 1:80841956-80841978 TCCCAAGTATAGGAGGTAGAAGG + Intergenic
912270266 1:108200960-108200982 ACCCATCTTGAGAAGGAGGAGGG - Intergenic
913302313 1:117385221-117385243 CCCCAGGTAGATGAGCAGGAGGG + Intronic
914720066 1:150282304-150282326 CCGCATGTAGGGGAGGAGCACGG + Intergenic
914798858 1:150945061-150945083 TCCCGAGTTGAGGAGGTGGATGG + Exonic
915167156 1:153954421-153954443 TCCCTTATAGAAGAGGAGAAAGG - Intronic
917028015 1:170663176-170663198 TCCCAGGGAAAGGAGGAAGAAGG + Intronic
917102246 1:171458386-171458408 TACCATGGACTGGAGGAGGAGGG + Intergenic
919780487 1:201217689-201217711 TGTCCTGTAGAGGAGGAGGTGGG - Intronic
919811032 1:201408965-201408987 TAACAAGTGGAGGAGGAGGAGGG - Exonic
919914076 1:202129398-202129420 TCCCAAAGAAAGGAGGAGGAAGG - Exonic
920011528 1:202871464-202871486 TGCTATGTGGTGGAGGAGGATGG - Intergenic
920041741 1:203102384-203102406 GCACATGTGGAGGAGGGGGAAGG - Intronic
920711025 1:208295173-208295195 CCCCCTGGAGAGGAAGAGGAGGG - Intergenic
921188373 1:212688998-212689020 ACCCATGCAGAAAAGGAGGAAGG - Intronic
922352802 1:224748098-224748120 TTCCAGGTACAGGAGGAGGAGGG - Intergenic
924064230 1:240207503-240207525 TACCCTGCAGAGGAGGAGGTTGG - Exonic
924452074 1:244187412-244187434 TCCCACCAAGGGGAGGAGGACGG + Intergenic
924464933 1:244291218-244291240 TCTCAAGTGGAGGAGAAGGAGGG + Intergenic
1064531654 10:16316572-16316594 TCCCATAAAGCGGAGAAGGAAGG - Intergenic
1065023013 10:21516570-21516592 TCAGAGGAAGAGGAGGAGGAGGG - Exonic
1065574163 10:27101530-27101552 TCCCTTGTGGAGGAGGTGGCTGG + Intergenic
1065850083 10:29780558-29780580 TCACAAACAGAGGAGGAGGAAGG + Intergenic
1066045425 10:31590749-31590771 ACCCAAATATAGGAGGAGGAAGG - Intergenic
1067524325 10:47029109-47029131 TGCCATGGAGCGGAGAAGGAAGG - Intergenic
1070929670 10:80252376-80252398 ACCCAGGTAGAGGAGGCGGCTGG - Intergenic
1071470389 10:85980111-85980133 TCCCAGGTGGGGAAGGAGGAAGG - Intronic
1071566464 10:86673801-86673823 GCACATCTAGAAGAGGAGGAAGG + Intronic
1073332119 10:102677110-102677132 TCCCAGGAGGAGGAGGAGGGAGG + Intronic
1073445403 10:103577314-103577336 TCCGATGGTCAGGAGGAGGAAGG - Intronic
1074053856 10:109904373-109904395 TTGCATGTAGAGGTGGATGAAGG - Intronic
1074412714 10:113242245-113242267 TGGCATGTGGAGGAGCAGGATGG + Intergenic
1074540945 10:114364788-114364810 CCCCCGGTAGTGGAGGAGGAAGG - Intronic
1076462287 10:130655572-130655594 TCTCATGTGGGGGCGGAGGAGGG - Intergenic
1076518397 10:131062883-131062905 TCCCAGGCAGAGGAGGGGCACGG + Intergenic
1077167785 11:1151623-1151645 TCCCAAGTCTAGGAGGAGGGTGG + Intergenic
1077781376 11:5333602-5333624 TACAAAGTAGAGGAGGAAGAAGG + Intronic
1078276800 11:9856412-9856434 CCCCAAGAAGAGTAGGAGGAGGG + Intronic
1078758763 11:14235062-14235084 TGCCAGGTAGAGGAGGGGAAGGG - Intronic
1078800335 11:14637276-14637298 TCCCAGGTGGACAAGGAGGAGGG - Intronic
1079238153 11:18704137-18704159 TGCCATGTAGATGTGGAGGAGGG + Exonic
1079698762 11:23518095-23518117 ACCCCAGCAGAGGAGGAGGAAGG + Intergenic
1082763558 11:57148948-57148970 TCCCATGTGGAGGAAAGGGAAGG + Intergenic
1083479380 11:62933886-62933908 CCCCAAGGAGAGGAGGAAGAGGG - Intergenic
1084120893 11:67068366-67068388 CCCCAGGGAGAGGAGGAGGAGGG + Intronic
1085849064 11:80098813-80098835 TCCAAATGAGAGGAGGAGGAGGG - Intergenic
1086058464 11:82675841-82675863 TCCCATATAGAGAGGGAGGCAGG + Intergenic
1087796970 11:102464399-102464421 TTCCATGGAGAGGTGGGGGATGG - Intronic
1089042193 11:115462613-115462635 TTTGATGTGGAGGAGGAGGAGGG + Intronic
1089083654 11:115798608-115798630 TACCAGGAAGAGGAGGAGGACGG - Intergenic
1090141167 11:124265008-124265030 TCCCAGGAAGACGAGGAAGAGGG - Exonic
1090144854 11:124310668-124310690 TCCCAGGAACAGGAGGAAGAGGG + Exonic
1092257254 12:6934159-6934181 TGACATCTACAGGAGGAGGAAGG - Exonic
1092951704 12:13509709-13509731 TCCCAGGCAGAGGAGCAGCAAGG + Intergenic
1093588174 12:20867953-20867975 GAACAGGTAGAGGAGGAGGAAGG - Intronic
1093684756 12:22043728-22043750 TTCCAGGAAGAGGAAGAGGATGG - Intergenic
1094741979 12:33300182-33300204 TTCCAAGAAGAAGAGGAGGAGGG + Intergenic
1095590126 12:43893932-43893954 TACCATGCAGAGGTGGAGAAAGG - Intronic
1097237714 12:57551039-57551061 TCCCAGGTACAGTAGGAAGAGGG + Intronic
1097679365 12:62634149-62634171 TCCCAGGTCACGGAGGAGGAGGG - Intergenic
1098655568 12:73024901-73024923 TCCCATGCAGAGGATATGGAAGG - Intergenic
1099169885 12:79350596-79350618 TCACATGTTGGGGAGGATGAGGG - Intronic
1101919679 12:108922349-108922371 TCCCATGGGGATGATGAGGAAGG - Intronic
1103005090 12:117414635-117414657 AGCCAGGAAGAGGAGGAGGAAGG - Intronic
1103125068 12:118414797-118414819 TACCATGGAGAAGAGCAGGAAGG + Exonic
1107107752 13:36664989-36665011 TCTCATGTAGAGTAGGTGAAGGG + Intergenic
1107771195 13:43788411-43788433 TCCCTTCTAGAGCAGAAGGATGG + Intergenic
1108545938 13:51493520-51493542 TCCCATGTGGAGGCTGAGAATGG + Intergenic
1112837630 13:103535512-103535534 TCCCATGCAGAAGAGAAAGATGG + Intergenic
1113099981 13:106706942-106706964 TCCCTTGGAAAGGAGGAGGGTGG - Intergenic
1118257043 14:64214425-64214447 TCTCACGAAGAGGACGAGGAGGG + Exonic
1118617632 14:67585684-67585706 GACCATGTTGAGGAAGAGGAGGG - Intronic
1118957459 14:70496463-70496485 TCTCATGGAGAGGAAGAGAAGGG + Intergenic
1119816693 14:77575386-77575408 TCCCATTTGGAGGTGGAGGAGGG + Intronic
1120470520 14:84918064-84918086 TGCCAAGAGGAGGAGGAGGAAGG - Intergenic
1121610041 14:95272303-95272325 CTCCAGGAAGAGGAGGAGGAGGG + Intronic
1122863932 14:104595064-104595086 CCCCATCCAGAGGAGGAGGCAGG - Intronic
1122932074 14:104938208-104938230 TCCCCTGAAGAGAAGGAAGAGGG - Exonic
1123165560 14:106322429-106322451 GCCCATGTACATGAAGAGGAGGG - Intergenic
1123472388 15:20565031-20565053 TCCCACCTGGAGGAGGAGGTTGG - Intergenic
1123645615 15:22435322-22435344 TCCCACCTGGAGGAGGAGGTTGG + Intergenic
1123732693 15:23160022-23160044 TCCCACCTGGAGGAGGAGGTTGG - Intergenic
1123750826 15:23357402-23357424 TCCCACCTGGAGGAGGAGGTTGG - Intronic
1124283197 15:28381318-28381340 TCCCACCTGGAGGAGGAGGTTGG - Intronic
1124299502 15:28530295-28530317 TCCCACCTGGAGGAGGAGGTTGG + Intronic
1124481785 15:30085889-30085911 TCCCACCTGGAGGAGGAGGTTGG - Intronic
1124488241 15:30137987-30138009 TCCCACCTGGAGGAGGAGGTTGG - Intronic
1124521806 15:30411312-30411334 TCCCACCTGGAGGAGGAGGTTGG + Intronic
1124536858 15:30554907-30554929 TCCCACCTGGAGGAGGAGGTTGG - Intronic
1124543331 15:30606961-30606983 TCCCACCTGGAGGAGGAGGTTGG - Intronic
1124755285 15:32400333-32400355 TCCCACCTGGAGGAGGAGGTTGG + Intronic
1124761794 15:32452684-32452706 TCCCACCTGGAGGAGGAGGTTGG + Intronic
1124776835 15:32596384-32596406 TCCCACCTGGAGGAGGAGGTTGG - Intronic
1125758727 15:42083231-42083253 TGCCATGTAGTGGAAGCGGAAGG + Exonic
1126368222 15:47917957-47917979 TCCCAAGAAGAAGAGGAGCAAGG - Intergenic
1126851473 15:52799468-52799490 TCCCCTGTAGAGAAGGAGGGAGG - Intergenic
1126943813 15:53794869-53794891 TCCCATTTTGGGCAGGAGGAAGG + Intergenic
1127325935 15:57895593-57895615 TCCCATACAGGAGAGGAGGATGG - Intergenic
1128198211 15:65779599-65779621 TCCCCTGTAGAGGCTGAGGTGGG - Intronic
1128253743 15:66182087-66182109 TGCCTTGCAGAGGAGGAGGCTGG - Intronic
1128331206 15:66756894-66756916 CTCCCTGTAGGGGAGGAGGAAGG - Intronic
1129411874 15:75354778-75354800 GCCCAAGAAGGGGAGGAGGAAGG + Exonic
1132091174 15:98949007-98949029 TCACATGGAGAGGATGAGTAAGG - Intronic
1133167260 16:3957119-3957141 TTCCTTGAAAAGGAGGAGGAAGG + Intronic
1133924728 16:10183131-10183153 TCCGAGGAAGAGGAGAAGGAAGG + Intergenic
1134062480 16:11207499-11207521 TCCCATGCAGTGGAGGAGACAGG - Intergenic
1134602060 16:15541364-15541386 TGCCAGGAAGAGGAGGAGGCTGG - Intronic
1134943385 16:18306458-18306480 TCCCCTGGAGAGGAACAGGATGG + Intergenic
1137586713 16:49668210-49668232 TCCCATGCTGAGTAGGAGGTGGG + Intronic
1137873138 16:51970170-51970192 TCCCAAGTAGAAGAGAAGGCAGG + Intergenic
1138150445 16:54651625-54651647 TGCCTTTTGGAGGAGGAGGATGG + Intergenic
1139276930 16:65736411-65736433 TTCCATGGAGAGGAGGAACAGGG - Intergenic
1139286072 16:65815525-65815547 TCCAATGCTGAGGAGGAGGCTGG - Intergenic
1139431321 16:66912425-66912447 CCCAATCTGGAGGAGGAGGAGGG + Exonic
1140854497 16:78965945-78965967 TCCAAAGTAGAGTTGGAGGAAGG + Intronic
1141424384 16:83935762-83935784 TCCCAGGGAGAGGAGGCGGCTGG + Intronic
1142233118 16:88909057-88909079 CCCCAGGCAGGGGAGGAGGAGGG + Intronic
1142766108 17:2065199-2065221 CGCCATGTGGAGGAGGAGGAGGG + Intronic
1143460713 17:7101796-7101818 GGTCATGAAGAGGAGGAGGATGG - Intronic
1143681880 17:8481885-8481907 TCCCATGGAGAGGAGGCAGGTGG + Intronic
1144951399 17:18996361-18996383 CCCCCTGGAGGGGAGGAGGAGGG - Intronic
1144968622 17:19093395-19093417 TTGCAGGAAGAGGAGGAGGAGGG + Intronic
1144979293 17:19158668-19158690 TTGCAGGAAGAGGAGGAGGAGGG - Exonic
1144988929 17:19219564-19219586 TTGCAGGAAGAGGAGGAGGAGGG + Intronic
1145750282 17:27350083-27350105 TGCCATGTTGACCAGGAGGATGG - Intergenic
1145792136 17:27633980-27634002 TTCCATGTGGTGCAGGAGGATGG - Intronic
1145980345 17:29007391-29007413 TTCCCTGTAGAGGAATAGGAGGG + Intronic
1147229190 17:39004773-39004795 ACGCATGTAGAGAAGCAGGATGG - Intergenic
1147390643 17:40107133-40107155 CCCAATTTAGAAGAGGAGGAGGG - Intergenic
1147894567 17:43742111-43742133 TCACATGGAGAGGGGGAGCAAGG + Intergenic
1147931614 17:43984666-43984688 TCGCCTGTAAAGGAGGAGGTGGG - Intronic
1148243027 17:46012587-46012609 TCCCAGGTAGAGAAGGAGCAGGG - Intronic
1148337387 17:46851201-46851223 TCCGAGGTAGAGAAGGTGGAGGG - Intronic
1148596730 17:48862354-48862376 TCCCATGAACTGGAGCAGGAAGG - Intronic
1148624989 17:49062446-49062468 TCCCAGCTAGAGCAGGAGGATGG + Intergenic
1148695521 17:49555971-49555993 TCCCAAGAAGAGAGGGAGGAGGG + Intergenic
1149026213 17:52030382-52030404 ACCCATGGAGAGGAGGAGGTGGG + Intronic
1149806193 17:59620044-59620066 TCCAAGGGAGAGGAGGAGAAGGG - Exonic
1152433803 17:80263256-80263278 TCCCCTTAAGAGGATGAGGAGGG + Intronic
1152587052 17:81193826-81193848 TCCCATGTAGAGGTGGGCGAGGG - Intronic
1152947651 17:83206641-83206663 TTCCATAAAGAGGAGGATGAGGG - Intergenic
1153619428 18:6963157-6963179 TTCCATGTAAACGAGGAGGCTGG + Intronic
1155305085 18:24470848-24470870 GGCCATGCAGAGGAGGAGAATGG - Intronic
1156132065 18:33988296-33988318 TCCCATGTATAGAAGTAGGGAGG - Intronic
1156350781 18:36299093-36299115 TTGCAAGTAGAGGAGGAGGTTGG + Intronic
1157097411 18:44698572-44698594 TCCTAGGTAGAGCAGGAAGAAGG - Intronic
1157512845 18:48290834-48290856 ACCTATGTGGAAGAGGAGGAGGG - Intronic
1158591187 18:58780337-58780359 TCTCATGTTGAGTTGGAGGAGGG - Intergenic
1158757596 18:60345306-60345328 TGCCAAGAGGAGGAGGAGGAGGG + Intergenic
1160243909 18:77142109-77142131 TGCCATGGAGAGGAGGAGAGAGG + Intergenic
1161249588 19:3273353-3273375 TCCTCAGTAGGGGAGGAGGAGGG - Intronic
1161440120 19:4286454-4286476 TCCCATGGAGAGGCTGAGGCTGG - Intronic
1161777926 19:6273923-6273945 TCCACTGGAGAGGGGGAGGATGG + Intronic
1161884044 19:6979675-6979697 TCCCAGATACAGGAAGAGGAGGG + Intergenic
1161894210 19:7068529-7068551 TCCCATCCAGAGGGGGACGAGGG - Intergenic
1162447029 19:10729738-10729760 TCCCAGGTAGAGCTGGAGGAAGG - Intronic
1162497394 19:11030910-11030932 CCCCAGGTCGAGGAGAAGGAAGG + Intronic
1164071113 19:21769053-21769075 TACCATGAAGAGGAGAAGCAAGG - Intergenic
1164608600 19:29617444-29617466 TCCCAGGTAGAGGAGGGAAAGGG + Intergenic
1166039268 19:40192026-40192048 TCCCCCATGGAGGAGGAGGAGGG + Exonic
1166050429 19:40255874-40255896 TGCCATGTAGAGGGTGAGGCTGG + Intronic
1166695440 19:44848970-44848992 CCCCACGTAGTGGAGGGGGAGGG + Intronic
1167401050 19:49269696-49269718 TCTGAGGGAGAGGAGGAGGAAGG - Intergenic
1167489126 19:49781737-49781759 TACCTGGGAGAGGAGGAGGAGGG - Exonic
1167596442 19:50430803-50430825 TCCCAGGAGGAGGAGGAGGAAGG + Exonic
1167750981 19:51380136-51380158 GCCACTGAAGAGGAGGAGGAGGG - Exonic
1168164015 19:54534184-54534206 ACCCAGGTGGAGGAGGAGGGAGG + Intronic
925667115 2:6270236-6270258 TCCCATGTTAATCAGGAGGAAGG + Intergenic
925881495 2:8356585-8356607 TACCATGTGGAGGAGCAGTATGG + Intergenic
927213793 2:20654566-20654588 TCCCAGGTAGAAGACAAGGAAGG - Intergenic
927812478 2:26187685-26187707 TCAGAAGAAGAGGAGGAGGAGGG - Exonic
928054011 2:28032337-28032359 TACCATGTAGAAGAGGAAAAGGG + Intronic
928088920 2:28362222-28362244 TCACGCGTGGAGGAGGAGGATGG - Intergenic
928090227 2:28369287-28369309 GCCCAGGCAGAGGAGCAGGAAGG - Intergenic
928922901 2:36543889-36543911 TCCCATTTAGGGGAAGAGAAAGG + Intronic
929275404 2:40020109-40020131 TCCAATGCAGAGAAGAAGGAAGG + Intergenic
929597230 2:43183948-43183970 TGCCATGGAGGGCAGGAGGAGGG + Intergenic
929759920 2:44798340-44798362 CCCCATGGGGAGGAGGAGGATGG - Intergenic
930495079 2:52131202-52131224 TCCTATGAAGAGAAGGAGGAAGG - Intergenic
930521621 2:52474560-52474582 GCCCTTGTAGAGGATGAAGAGGG - Intergenic
930869398 2:56154560-56154582 TCCCAAAGAGAGGTGGAGGAAGG + Intergenic
931442391 2:62299444-62299466 TGCCAGGAGGAGGAGGAGGAGGG + Intergenic
931681101 2:64750698-64750720 CCCCAGGCAGAGGAGGAGGCTGG + Intronic
932072759 2:68637234-68637256 TCTCAGATAGAGGAGGAGGTGGG + Intergenic
932707506 2:74038098-74038120 TGCACTGTAGAGGAGGAGGCAGG + Intronic
934656887 2:96121077-96121099 ACACGTGTAGAGGAAGAGGAAGG - Intergenic
934818519 2:97351667-97351689 CCCCATGTAAATGAAGAGGAGGG - Intergenic
935353685 2:102178092-102178114 TCCTAGGCAAAGGAGGAGGAAGG - Exonic
936107085 2:109633721-109633743 TCCCAGGTAGAGGATGAAGCTGG + Intergenic
936665545 2:114591087-114591109 TCCCATGCAGAGCAGGGAGAAGG + Intronic
937553773 2:123129184-123129206 TCCCATAAAGAGGAGGAGAGGGG + Intergenic
938238524 2:129724920-129724942 TCCCATGTGGAAGAGCAGGAGGG - Intergenic
940460133 2:153954507-153954529 GCCCATGTAGAAGAGCAGAAGGG - Intronic
942227831 2:173832208-173832230 TTCCATGTGGAGTAGGCGGATGG - Intergenic
943719437 2:191188395-191188417 TCCCATGGAGAGGTGGAGAATGG + Intergenic
944212638 2:197222255-197222277 ACTCAAGAAGAGGAGGAGGAGGG + Intronic
947119374 2:226799661-226799683 TCCGAGGAGGAGGAGGAGGAGGG - Exonic
947581454 2:231321744-231321766 TCACATGGAGAAGAGGAAGAGGG - Intronic
1168833310 20:859352-859374 GCCCATGCAGAGGAAGAGGTTGG - Intergenic
1168900309 20:1358303-1358325 TCCCATGGGAAGAAGGAGGAGGG + Intronic
1170085724 20:12529686-12529708 TCCCATGTAGTGCAGCAAGAGGG + Intergenic
1173161488 20:40655970-40655992 TTCCAGGTAGAGGAGGAAGGTGG - Intergenic
1174194796 20:48765615-48765637 AGTCATGCAGAGGAGGAGGACGG + Intronic
1174495405 20:50938088-50938110 TACCATGTGGATGGGGAGGAAGG - Intronic
1175183490 20:57164850-57164872 TCCCAGGACGAGGAGGAGGAAGG + Intergenic
1175338995 20:58215689-58215711 TCCTCTGTAGAGGAGGAAGGAGG - Intergenic
1178178355 21:30130725-30130747 TCCCATGTATAAGAGGAGAGGGG - Intergenic
1178400334 21:32279707-32279729 TTCCATGAAGTGGAGAAGGAAGG + Intergenic
1178812038 21:35893257-35893279 TTCCATGCAGAGGAAGAGGTGGG - Intronic
1179513465 21:41890706-41890728 ACCCATGTTGAGGAGGTTGAAGG + Intronic
1179788079 21:43741053-43741075 TCCCAGGTACAGGAGGAGCGTGG - Intronic
1181335669 22:22125989-22126011 GCCCACCTAGAGGAGTAGGAGGG + Intergenic
1182308505 22:29388274-29388296 CCCCAGCCAGAGGAGGAGGAAGG - Intronic
1182647973 22:31825847-31825869 TACCATGTGGAAGAGGAGGCAGG - Intronic
1183191955 22:36327321-36327343 TCCCTTGGAGAAGTGGAGGAGGG + Intronic
1183323043 22:37176696-37176718 TGCCAAGTGGAGGAGGAGGCGGG + Intergenic
1183642560 22:39101336-39101358 TCCCAGGCACAGGAGGAGCAGGG - Exonic
1184235780 22:43182330-43182352 TCCCAGCTGGAGGAGGAGGCGGG + Intronic
1184669276 22:46004311-46004333 TCCCAGGTAGAGGGGCTGGAGGG + Intergenic
1184764642 22:46565277-46565299 TCCCATGGAGAGAGGAAGGAGGG + Intergenic
1184881446 22:47306917-47306939 TCTCATGTAGAATTGGAGGAGGG + Intergenic
949990684 3:9576558-9576580 ATCCATGTTAAGGAGGAGGAAGG - Intergenic
950583250 3:13876730-13876752 TTCCAGGGAGAGGAGGAGCAAGG - Intronic
952258274 3:31714206-31714228 TACCGAGTAGAGGAGAAGGAAGG - Intronic
952513317 3:34078617-34078639 TCCCCTGTGGAAGAGTAGGAAGG + Intergenic
952740342 3:36728545-36728567 TCCCAGGAGGAGGGGGAGGAGGG - Intronic
954300759 3:49699647-49699669 TCCTGTGTGGAGGGGGAGGAGGG - Exonic
954675518 3:52313374-52313396 TTCCCTTTACAGGAGGAGGAGGG - Intergenic
954957009 3:54530112-54530134 TCCCAAGAAGTGAAGGAGGAGGG - Intronic
955399974 3:58584771-58584793 TCCTATGTAGATGAAGAGGATGG - Intronic
955867067 3:63396396-63396418 TCCCATGTCTAGGGGGAGGAAGG + Intronic
957070306 3:75562712-75562734 TCTCTTGGAGAGGAGGAGAAAGG + Intergenic
960203382 3:114865526-114865548 ATCCATGTATAGGAGGTGGAAGG - Intronic
960530364 3:118757334-118757356 TCCCATGCAGAGGAGTGGCAAGG + Intergenic
961174526 3:124822885-124822907 AGCCAGGGAGAGGAGGAGGAGGG + Intronic
961339976 3:126211584-126211606 TCAGATGCAGAGGCGGAGGACGG - Intergenic
961381105 3:126497095-126497117 TCACCTGTGGAGGAGGAGGCGGG - Intronic
961497645 3:127306149-127306171 TGCCATGCAGAGGAGGAGTGGGG - Intergenic
962110758 3:132444119-132444141 TCTCATGTGCAGGAGGTGGATGG - Intronic
962230661 3:133662547-133662569 TCCACTGAAGGGGAGGAGGAGGG - Intergenic
963707763 3:148709375-148709397 TCCCAAATAGAGTAGAAGGAAGG - Intronic
965638053 3:170804364-170804386 TCTCATGCTGAGGAGGAGGCTGG - Intronic
965770462 3:172176535-172176557 TTTCATGTACAGGAAGAGGAAGG + Intronic
966119409 3:176505927-176505949 TCCCTTGTACAGAGGGAGGAGGG + Intergenic
966141288 3:176759399-176759421 TTCCAACTGGAGGAGGAGGATGG + Intergenic
966361938 3:179139161-179139183 TCCCAAATAGTTGAGGAGGAAGG + Intergenic
967829790 3:193909235-193909257 GTCCATGTGGAGGAGAAGGACGG + Intergenic
968442159 4:629510-629532 TCCCAGGGAGAGGAGCTGGAAGG - Intronic
968680843 4:1918398-1918420 TCCCATGAAGAGAAGGCGGAGGG + Exonic
969547814 4:7843290-7843312 TATGATGAAGAGGAGGAGGATGG - Exonic
970225233 4:13850650-13850672 TCCCAAGCAGAGCAGGAGAAAGG - Intergenic
971704547 4:30023437-30023459 TGCCATGTTTAGGAAGAGGAAGG - Intergenic
972274049 4:37540777-37540799 CCCCATGTAGAGGTGGGGGTGGG + Intronic
972426783 4:38940854-38940876 TCTCTTGCAGAGGAAGAGGAGGG - Intronic
972641123 4:40925958-40925980 TCAGATGGAGAGGAAGAGGAAGG - Intronic
975822679 4:78287737-78287759 TCCTATGTGGAGGAGGCTGATGG + Intronic
975859096 4:78657142-78657164 TCCTTTGAAGAGGAAGAGGAAGG - Intergenic
978305548 4:107323885-107323907 TCCCATGCAGAGGAACAGAAGGG - Intergenic
978453161 4:108859206-108859228 TCCCATCTACAGAATGAGGATGG - Intronic
978745235 4:112185903-112185925 TCACAGGTAGAGAAGGAAGAAGG - Intronic
979547714 4:121956222-121956244 TCCCATAGTGAGGAGGGGGAGGG + Intergenic
980487381 4:133476237-133476259 TCCCACGTACAGAAGCAGGAGGG - Intergenic
982364576 4:154561216-154561238 TCCCATGGTCAGAAGGAGGATGG - Intergenic
983404921 4:167315718-167315740 GCCCATCTAGAGGAAGAGTAGGG - Intergenic
983721433 4:170857393-170857415 TACAATTTAGAGGAAGAGGAAGG + Intergenic
984866456 4:184284329-184284351 TCCCAAGAAGGGGAGGAGCAGGG - Intergenic
985485485 5:146175-146197 TACCATGGAAAGGAAGAGGAGGG - Intronic
985843033 5:2323716-2323738 TCTCATGTAGAATTGGAGGAAGG - Intergenic
986007725 5:3682007-3682029 TCCCATTTGGAGGGGGTGGAGGG + Intergenic
986720669 5:10558854-10558876 TCCCATGCAGAGCAGGAAAAAGG + Intergenic
987896649 5:23954681-23954703 TCCCAAATAAATGAGGAGGAAGG - Intronic
991651825 5:68863417-68863439 TCCCATGGAGAGGAGTAAGTAGG - Intergenic
992278567 5:75148341-75148363 CTCCATAAAGAGGAGGAGGAAGG + Intronic
992550929 5:77859054-77859076 AGCCAAATAGAGGAGGAGGAGGG - Intronic
993007139 5:82440926-82440948 AAGCAGGTAGAGGAGGAGGATGG - Intergenic
996532589 5:124541982-124542004 TCTCACCTAGATGAGGAGGATGG - Intergenic
997050249 5:130371568-130371590 TGCCAAGTAGAGGAGGGGCAGGG + Intergenic
997530607 5:134579225-134579247 TCAGATGTAGAGGCCGAGGACGG + Exonic
998359628 5:141573800-141573822 TCCCAGGCAAAGGAGGAGGTGGG + Exonic
998684301 5:144506171-144506193 TCACAGGCAGAGGAAGAGGAGGG + Intergenic
999134274 5:149307440-149307462 TACGATGAAGAGGAGGAGGAAGG + Exonic
999494876 5:152086921-152086943 TCCCTTGTTGGGGAGGGGGAGGG + Intergenic
999692527 5:154160955-154160977 TCCCATGCCTAGGAGGAGGCAGG - Intronic
1000433816 5:161183297-161183319 ACTCATGGAGAGGAGAAGGATGG + Intergenic
1002026849 5:176401534-176401556 GCCCTTGTAGGGGAGGAGGAAGG + Intronic
1002080086 5:176732592-176732614 TGCCTTGCAGAGGACGAGGAAGG - Intergenic
1002161204 5:177314958-177314980 GTCCATGGAGTGGAGGAGGACGG - Intergenic
1002175028 5:177396856-177396878 GCCCATGTAGAGGTGGAGTGGGG + Intronic
1002257919 5:177972645-177972667 TGCCATGGAGAAGAGCAGGAAGG + Intergenic
1002741818 5:181439795-181439817 TTCCATAAAGAGGAGGATGAGGG - Intergenic
1002782470 6:378011-378033 TACAATGCAAAGGAGGAGGATGG + Intergenic
1002857974 6:1055119-1055141 TTCCATGTGGAGGGGGAGGGTGG + Intergenic
1004013603 6:11712093-11712115 TCCCCGTTACAGGAGGAGGAAGG - Intronic
1004954942 6:20719176-20719198 GCCACAGTAGAGGAGGAGGATGG + Intronic
1005882205 6:30070417-30070439 TCCCAGGTTGAGGAGGAGAGAGG + Exonic
1006510638 6:34519325-34519347 TCCCAAGTTGAGGAGGAAGGAGG - Intronic
1009333902 6:62460980-62461002 TCTGATGTGGAGGAGGAGAAAGG - Intergenic
1010176154 6:73030588-73030610 TCATAGGTAGAAGAGGAGGAAGG + Intronic
1011811882 6:91141653-91141675 TTCCAGGAAGAGAAGGAGGAAGG - Intergenic
1011993865 6:93559864-93559886 TGCCATGGACAGGAGGGGGATGG + Intergenic
1012418087 6:99031717-99031739 TCGCGTGTAGAGGAGGTGGCTGG + Intergenic
1013043340 6:106458776-106458798 TCCCATGTGCGGGAGGAGAAGGG - Intergenic
1014269006 6:119314825-119314847 GCCGAAGTGGAGGAGGAGGAAGG - Intronic
1014593808 6:123307376-123307398 TTCCATGAAGAGGAGGAGCAAGG - Intronic
1015823788 6:137291047-137291069 GCCCAGGTAGAGGTGGAGGCTGG + Intergenic
1017382083 6:153843022-153843044 TTAAATGTAGAGGAAGAGGAGGG - Intergenic
1018190319 6:161304562-161304584 TCCCCTGAAGAGGAGGAGATTGG - Intergenic
1018213302 6:161503151-161503173 TCCCATGTAGAGGGAGGAGATGG + Intronic
1018577705 6:165276753-165276775 TTCCATGAGGATGAGGAGGAAGG - Intergenic
1018600295 6:165531011-165531033 TCCCATGTAGAGGAGGAGGATGG - Intronic
1019061578 6:169261140-169261162 GCCCATGCAGAACAGGAGGAAGG - Intergenic
1019246958 6:170715552-170715574 TTCCATAAAGAGGAGGATGAGGG - Intergenic
1019684299 7:2372256-2372278 TGCCATGGAGAAAAGGAGGAAGG + Intronic
1020136660 7:5591838-5591860 TCCCCTTTGGGGGAGGAGGATGG + Intergenic
1020158121 7:5744430-5744452 TCTTTGGTAGAGGAGGAGGAAGG + Intronic
1021975275 7:26006392-26006414 TCCCATCCAGAGGTGGATGAGGG - Intergenic
1022056536 7:26741400-26741422 TCCCAGCCAGTGGAGGAGGAGGG + Intronic
1023464553 7:40439721-40439743 TCCCATGTCGAGGAGGACTCAGG - Intronic
1024720925 7:52136932-52136954 GACTATGAAGAGGAGGAGGAGGG + Intergenic
1025228260 7:57181873-57181895 ACGCCTGTAAAGGAGGAGGAGGG - Intergenic
1029010225 7:97252421-97252443 TCCCATGCAGAGAAGGAGAAGGG - Intergenic
1029090011 7:98040691-98040713 TCCCAAGGAAAGGAGGATGATGG + Intergenic
1029280031 7:99429550-99429572 CCCCATGAAGGGGAGCAGGACGG + Intronic
1029851967 7:103470965-103470987 TCACAGTTAGTGGAGGAGGAAGG - Intergenic
1030556408 7:111030457-111030479 TCCCATGTGAAGGAAGAGAAAGG - Intronic
1032405119 7:131650267-131650289 GACCATGTGGAGGAGGTGGAAGG - Intergenic
1032406915 7:131662984-131663006 TCCCATGTGGAGAATGATGAGGG + Intergenic
1033440328 7:141372605-141372627 ACCCATATAGATGAGGAGGGAGG - Intronic
1035219392 7:157396876-157396898 TCCCATGTAGAAAAGGAGGCGGG - Intronic
1035248079 7:157577945-157577967 TCCCATTCGGAGGAGGAGCAGGG + Intronic
1035398683 7:158551223-158551245 TCCCATGGTGGGAAGGAGGAGGG + Intronic
1035501183 8:92401-92423 TTCCATAAAGAGGAGGATGAGGG + Intergenic
1035732062 8:1860325-1860347 GGGCATGGAGAGGAGGAGGAGGG - Intronic
1035732084 8:1860392-1860414 GGGCATGGAGAGGAGGAGGAGGG - Intronic
1035732102 8:1860456-1860478 GGGCATGGAGAGGAGGAGGAGGG - Intronic
1035879691 8:3232136-3232158 TCCCCTGAAGTGGAGGAAGAAGG - Intronic
1037547512 8:19939268-19939290 TCCCTTGAGGAGGAGGAAGAGGG - Exonic
1039176903 8:34818620-34818642 TCAGCTGAAGAGGAGGAGGAAGG - Intergenic
1039391468 8:37184378-37184400 TGGCATTTAGAGAAGGAGGAAGG - Intergenic
1039443546 8:37612345-37612367 GCCCATGGGGAGAAGGAGGAAGG + Intergenic
1040692843 8:49960823-49960845 TCCCAAAGAGAGGAGGAGGAGGG - Intronic
1040980542 8:53242175-53242197 GCACATGGAGAGGAGGATGATGG + Intronic
1042519740 8:69698959-69698981 TCCAATGTGAAGCAGGAGGATGG + Intronic
1042784122 8:72527733-72527755 TCATATGAAGAAGAGGAGGAAGG + Intergenic
1042863438 8:73335856-73335878 TCAAGTGTAGAGGTGGAGGAAGG - Intergenic
1045825340 8:106390335-106390357 TCTCTTGGAGAGGAGGAGAAGGG + Intronic
1046770550 8:118112416-118112438 TGCTATGTAGAGGAGGAGTAAGG - Intergenic
1048190555 8:132284521-132284543 TCCCATGGAGAGGAGGAAAGGGG + Intronic
1048279053 8:133091282-133091304 TCACATGGAGAGGGGAAGGATGG - Intronic
1048794600 8:138138189-138138211 TCTCCTGTGGAGGAGGAGGAGGG - Intronic
1048985163 8:139731172-139731194 TCCCGTGTAGAGGAAGAGGAGGG + Exonic
1050394628 9:5182383-5182405 TGCCAAGGAGAGGAGGAGAATGG + Intronic
1050951162 9:11596209-11596231 ACTCATGTAGAGATGGAGGAGGG + Intergenic
1055416332 9:76087844-76087866 TCAGATGTGGAGGAAGAGGAGGG + Intronic
1055797700 9:79993324-79993346 CCCCATGAAGGGGAGGAGAAGGG - Intergenic
1056119549 9:83473655-83473677 TAACATGGAGAGGAGGAAGAGGG + Intronic
1056158177 9:83860708-83860730 TCCAGTGTGGAGCAGGAGGATGG - Intronic
1056352371 9:85763349-85763371 TCCAGTGTGGAGCAGGAGGATGG + Intergenic
1057860990 9:98640685-98640707 CCCCCTGGAGAGGAGGAGGAGGG + Intronic
1058508145 9:105687570-105687592 TCACAGGGAGAGGAGTAGGAAGG - Intergenic
1059540084 9:115121569-115121591 TCCCGGGAAGAGGAGGAGGAAGG - Intergenic
1060668583 9:125448510-125448532 TCTCAGGTAGAAGAGGAAGAGGG + Intronic
1060962095 9:127688224-127688246 TCCCATGTGTAGGATGAGAAGGG + Intronic
1061038152 9:128124789-128124811 TCCCAGGTAGAGGGGCAGGGTGG + Intronic
1061429641 9:130523095-130523117 TCCCATCCAGAGGAAGGGGAAGG - Intergenic
1203607729 Un_KI270748v1:71011-71033 TTCCATAAAGAGGAGGATGAGGG - Intergenic
1187127672 X:16469301-16469323 ACCCAAGCAGAGGGGGAGGAGGG + Intergenic
1188735807 X:33713890-33713912 TCATATGTAGAGGAGTAGAATGG - Intergenic
1189100967 X:38189261-38189283 TCCCAGCTAGAGGTTGAGGATGG - Intronic
1189620538 X:42832579-42832601 TCCCATGTAGAGAATCAGAATGG - Intergenic
1189750160 X:44212538-44212560 TCCCATCTAGAGTAGGGGGAGGG + Intronic
1195086493 X:101418509-101418531 TCCCATTAGGAGGAGGGGGAGGG + Intronic
1196002052 X:110796261-110796283 TCCAGTGCAGAGGGGGAGGAGGG - Intergenic
1196808524 X:119609872-119609894 TGCAATAGAGAGGAGGAGGATGG - Intergenic
1197252545 X:124230479-124230501 TCCCGTATGGAGGTGGAGGAGGG + Intronic
1198004836 X:132482432-132482454 ACCCATCTAAATGAGGAGGAAGG - Intronic
1200822838 Y:7605795-7605817 GAACAGGTAGAGGAGGAGGAGGG + Intergenic
1202237217 Y:22725294-22725316 GAACAGGTAGAGGAGGAGGAGGG - Intergenic