ID: 1018602875

View in Genome Browser
Species Human (GRCh38)
Location 6:165563985-165564007
Sequence GATCAGTGGGAGAGGGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 626
Summary {0: 1, 1: 0, 2: 3, 3: 47, 4: 575}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018602875 Original CRISPR GATCAGTGGGAGAGGGTGGA GGG (reversed) Intronic
900347389 1:2216221-2216243 GTTCAGTGGGTGAGGGTGGCAGG + Intergenic
900595360 1:3477867-3477889 GATCAGTGGGAGGGACTGGGGGG - Exonic
901270815 1:7952100-7952122 CATCAGAGGGAGACCGTGGAAGG - Intergenic
901639320 1:10685494-10685516 GATGAGAGAGAGAGGGAGGAAGG - Intronic
901876323 1:12168798-12168820 GATCAGCGGGAGAGGGGGCAGGG - Intronic
902202648 1:14845274-14845296 GATGAGTGAGTGGGGGTGGATGG + Intronic
902792324 1:18777763-18777785 GATCAGTGAGTGTGGATGGAAGG + Intergenic
902882404 1:19381290-19381312 CATCTGTGTGAGAGGGAGGAGGG - Intronic
903004895 1:20292022-20292044 GGTTAGTGGGAGAGGCAGGATGG - Intronic
903081191 1:20814806-20814828 CATCAGAGGGAGACCGTGGAAGG - Intronic
903961943 1:27063469-27063491 CATCAGAGGGAGACCGTGGAGGG - Intergenic
904031246 1:27534783-27534805 GATGGGTGGGAGGGGGTGGAGGG + Exonic
904784943 1:32975812-32975834 CATCAGAGGGAGACCGTGGAAGG + Intergenic
905204720 1:36336832-36336854 GGTTAGGGGGAGAGGCTGGAAGG - Intergenic
905401786 1:37708925-37708947 CATGAGTGCGAGAGGGTAGACGG - Exonic
905521335 1:38602927-38602949 GACCAGTGGGAGAGGCAGAAAGG + Intergenic
906204550 1:43979802-43979824 GGGCAGGGGGAGTGGGTGGAGGG - Intronic
906427034 1:45724005-45724027 CATCAGAGGGAGACCGTGGAAGG - Intronic
906762081 1:48384308-48384330 CATCAGAGGGAGACCGTGGAGGG + Intronic
907225451 1:52942101-52942123 GATCTGTGGGAGAGAGAGGTAGG + Intronic
907281029 1:53347110-53347132 CATCAGTGGGAATGGGTGAAGGG + Intergenic
907477631 1:54716005-54716027 GACCAGTGGGAGAAGGTGGGCGG + Exonic
907516049 1:54994124-54994146 GAGCAGGGGGAGAGAGTGGCAGG - Intergenic
907530582 1:55091494-55091516 GTTCAGTGGGAGATCGTGAAAGG - Intronic
907954809 1:59217883-59217905 GAGCAGAGGGAGAGGGTAAAAGG - Intergenic
907968287 1:59355086-59355108 GATCAGTGGGAAATGGTTGATGG + Intronic
908116949 1:60949928-60949950 GAGCAATGGGAGGTGGTGGAGGG + Intronic
908445986 1:64200488-64200510 CATCAGAGGGAGACCGTGGAAGG - Intergenic
909641302 1:77871058-77871080 CATCAGAGGGAGACCGTGGAAGG + Intronic
911012376 1:93294627-93294649 GTGCAGTGGGAAAGTGTGGATGG + Intergenic
911218250 1:95218884-95218906 GAGCTTTGGGGGAGGGTGGAGGG + Intronic
911449809 1:98048590-98048612 GAGAAGGGGGGGAGGGTGGATGG - Intergenic
911459507 1:98171857-98171879 GATGACTGGGTGAGGATGGATGG + Intergenic
911517983 1:98891590-98891612 GACCTGGGGGTGAGGGTGGAAGG + Exonic
911550382 1:99271720-99271742 GATCAGTGGGTGGGGGTGAGAGG + Intronic
912430859 1:109627681-109627703 GATCAGAGGGAGCAGGTGGGAGG - Intronic
912751529 1:112292605-112292627 CATCAGAGGGAGACCGTGGAAGG - Intergenic
913099172 1:115547272-115547294 GATGAGGGGGAGAGGGAGCAGGG - Intergenic
913180194 1:116313328-116313350 GATGTGTGGGGGAGGGGGGAAGG - Intergenic
914887840 1:151599612-151599634 CATCAGAGGGAGACCGTGGAAGG - Intergenic
914977603 1:152380414-152380436 GATAAGGGGGAGAGAGTGAAAGG - Intergenic
916193242 1:162199044-162199066 GATAACTGGAAGAGGGTGTAAGG - Intronic
916326238 1:163562947-163562969 TATCAGAGGGTGAGGGTGGGAGG - Intergenic
917265493 1:173216564-173216586 GATCAGAGACTGAGGGTGGATGG + Intergenic
917304449 1:173612614-173612636 CATCAGAGGGAGACTGTGGAAGG - Intronic
918128835 1:181607458-181607480 GACCAGTGGGAAGGGGAGGAAGG - Intronic
918143283 1:181735466-181735488 GAGCAGTGGGCGAGGGTGACTGG + Intronic
918708341 1:187696387-187696409 TCTCAGTGGGAGAGGGTAGGAGG + Intergenic
920926069 1:210342966-210342988 GATAAGTGGGCGAGTGTTGAAGG + Intronic
922040190 1:221888847-221888869 GAACAGTGTGAGAAGGAGGATGG + Intergenic
922040197 1:221888892-221888914 GAACAGTGTGAGAAGGAGGATGG + Intergenic
922176598 1:223202384-223202406 GATCAGTGGGGGAGGGAGAGGGG - Intergenic
922436781 1:225615004-225615026 CATCAGAGGGAGACCGTGGAGGG - Intronic
922870682 1:228899716-228899738 GATCTCTGGGAGAGGCTGGCTGG + Intergenic
923622038 1:235587467-235587489 GGTGAGTGTGAGAGTGTGGATGG + Intronic
923623425 1:235595576-235595598 GAACCATGGGACAGGGTGGATGG - Intronic
923934147 1:238742873-238742895 GAAAAGGTGGAGAGGGTGGAAGG + Intergenic
924685474 1:246285114-246285136 GACCTGGGGGACAGGGTGGAGGG - Intronic
1062979208 10:1707890-1707912 GGTCAGTGGGAGAGGTTGCAGGG + Intronic
1062984759 10:1757857-1757879 GAGCAGTGGAAGAGGGTGTGAGG + Intergenic
1063084831 10:2806952-2806974 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1063948192 10:11197680-11197702 GGTCGGTGGCAGAGGGAGGAGGG + Intronic
1064108823 10:12520901-12520923 CATCAGAGGGAGACCGTGGAAGG + Intronic
1066031399 10:31429528-31429550 TACCAGTGGTGGAGGGTGGAAGG + Intronic
1067481486 10:46602270-46602292 GTACAGTTGGAGAGAGTGGAGGG + Intergenic
1067613266 10:47739459-47739481 GTACAGTTGGAGAGAGTGGAGGG - Intergenic
1068969434 10:62947048-62947070 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1069986914 10:72290887-72290909 GATGGGTGGGAGAGGGAGGCTGG + Intergenic
1070013310 10:72498253-72498275 TATCAGTGGGAGAAAGTAGATGG - Intronic
1070605235 10:77893806-77893828 GATCAATGGGGGATGGGGGAAGG + Intronic
1071564682 10:86665604-86665626 GAGCAGTGGGGGAGGTTGCATGG - Intronic
1071628676 10:87199564-87199586 GTACAGTTGGAGAGAGTGGAGGG - Intergenic
1071814757 10:89221039-89221061 GATCAGTGGGATTGAGGGGAGGG + Intronic
1072405101 10:95144161-95144183 GATTAGTGGGAGGTGGTGAAAGG - Intergenic
1072602565 10:96942415-96942437 CATCAGAGGGAGACCGTGGAAGG + Intronic
1073768656 10:106710744-106710766 GAGAAGTGGGGGAGGTTGGAGGG - Intronic
1074387962 10:113032140-113032162 GACTTTTGGGAGAGGGTGGAAGG + Intronic
1074691336 10:116007335-116007357 GACAAGTAGGAGAGGGAGGAGGG + Intergenic
1074872003 10:117584285-117584307 GATCAGGGGGCCAGGGTGGCAGG + Intergenic
1075593570 10:123710449-123710471 GATCAGGTGGAGCAGGTGGAGGG + Intronic
1076885950 10:133262382-133262404 GATCAGCGGGGAAGGATGGAGGG - Exonic
1077859264 11:6160494-6160516 GTTCAGTGGGCGGGGGTGGGGGG + Intergenic
1078176713 11:8977391-8977413 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1078456862 11:11482362-11482384 GGTCTGTGGGCCAGGGTGGAGGG - Intronic
1078841556 11:15080318-15080340 GATCAGAGGCTGAGGGTGGAAGG - Intronic
1080790857 11:35521349-35521371 AATGAGAGGGAGAAGGTGGAAGG - Intronic
1081704441 11:45172885-45172907 GAGCAGGGGGACAGGGTGGTAGG - Intronic
1082250857 11:49978532-49978554 GAAGAGTGGGAGGGGGTCGAGGG + Intergenic
1082832757 11:57631387-57631409 GAACAGTTGGAGAGGTAGGAGGG + Intergenic
1082986561 11:59174384-59174406 CATCAGAAGGTGAGGGTGGAGGG + Intronic
1084498100 11:69517116-69517138 GGCCAGTGGGAAAGGCTGGAGGG - Intergenic
1085242305 11:75068196-75068218 GCTCAGGGAGAGAGGGTGGGTGG - Intergenic
1085480711 11:76820825-76820847 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1085501602 11:77029835-77029857 GGTCAGTGAGAGAGGGAAGAGGG - Intergenic
1085820377 11:79786689-79786711 GATGGGCGGCAGAGGGTGGAGGG + Intergenic
1086877806 11:92118402-92118424 GAAGAGTGGGAGGGGGTTGAGGG + Intergenic
1087077093 11:94135193-94135215 GGTCAGTGGGTGAGGGAGGCAGG - Intronic
1087487148 11:98770727-98770749 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1087805895 11:102555058-102555080 GATCAGAGAGACAGGGAGGAAGG - Intergenic
1088098592 11:106129407-106129429 GAGCAGTTGGAGAGGGTGGAGGG + Intergenic
1088688607 11:112305622-112305644 GATCAAGGGGAGAGGGTGGTTGG + Intergenic
1088953958 11:114599407-114599429 GATAACAGGCAGAGGGTGGAGGG - Intergenic
1089072825 11:115714423-115714445 GGTAAGTGGGAAGGGGTGGAAGG + Intergenic
1089329206 11:117678158-117678180 GATGAGAGGAAGAGGGTGAAAGG - Intronic
1090075938 11:123580057-123580079 GATCAGTGGGAGAATGAGGTGGG - Intronic
1090305031 11:125683974-125683996 GAGTAGAGGGAGAGGTTGGAAGG - Intergenic
1090556582 11:127883087-127883109 GACCAGTGGGAGAGAGAAGACGG - Intergenic
1090907061 11:131085118-131085140 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1090982130 11:131732407-131732429 GAGAAGGGGTAGAGGGTGGAAGG - Intronic
1091713376 12:2758848-2758870 GCTCAGGGGGAAAGGGTGGGAGG + Intergenic
1091789043 12:3260777-3260799 GCTGAGTGGTGGAGGGTGGAGGG + Intronic
1092002317 12:5043210-5043232 GATTCGTTGGAGCGGGTGGAGGG + Intergenic
1092443938 12:8536114-8536136 GGTCAGTGGCAATGGGTGGACGG - Exonic
1092453373 12:8624380-8624402 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1092722422 12:11454930-11454952 TATCAGAGGGTGAAGGTGGAAGG + Intronic
1092828026 12:12415522-12415544 CATCAGAGGGAGACCGTGGAAGG + Intronic
1092880560 12:12884819-12884841 GACCAAGGGGAGAGGCTGGAAGG + Intergenic
1094103084 12:26784374-26784396 CATCAGAGGGAGACCGTGGAAGG - Intronic
1094330803 12:29290857-29290879 GGCAAGTGGGAGGGGGTGGATGG + Intronic
1095924205 12:47562382-47562404 AAACAGTGGTAGGGGGTGGAGGG - Intergenic
1096685850 12:53287945-53287967 GATCAGAGTGAAAGGGTGAAGGG - Intronic
1097232878 12:57522940-57522962 GGTGAGTGGGAGGGGGTGGGAGG - Exonic
1097451010 12:59736853-59736875 GCTCAGTGGGAGGGATTGGAAGG - Intronic
1098379700 12:69854317-69854339 CATCAGAGGGAGACCGTGGAGGG + Intronic
1098412435 12:70201154-70201176 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1098876540 12:75871861-75871883 AAGCAGTGGGAGTGGGAGGAGGG - Intergenic
1099919219 12:88936371-88936393 GATCCATGGGAATGGGTGGAGGG + Intergenic
1100389903 12:94139279-94139301 GCTCAGTGGGCCAGGGTGGCTGG + Intergenic
1100712565 12:97274035-97274057 GGTCTGTGGGAGATGGTGGAAGG - Intergenic
1101643442 12:106605917-106605939 AAGAAGTGGGAGAGGGTGGGAGG - Intronic
1102283900 12:111639654-111639676 GGCCAGTGGGTGAGGGTGGGAGG + Intergenic
1103918533 12:124388044-124388066 GGGCAGTGGGAGTGGGTTGAGGG + Intronic
1103922311 12:124405366-124405388 AACCAGAGGGTGAGGGTGGAAGG - Intronic
1104091513 12:125521611-125521633 GGCCAGAGGGTGAGGGTGGAGGG + Intronic
1104108270 12:125683827-125683849 GGGCAGTGGGCGAGGCTGGAGGG - Intergenic
1104577864 12:129984355-129984377 GCTCTGTGGGAGATGGTAGAAGG + Intergenic
1106306649 13:28517032-28517054 GATCTGGGGGAAAGGGTGGGAGG + Intergenic
1106555630 13:30805909-30805931 GATGTGTGGGAGAAGGTTGAGGG + Intergenic
1106593387 13:31116934-31116956 GGGCAGAGGGAGAGGGAGGAGGG + Intergenic
1111330324 13:86757558-86757580 GGTCAGTGGGAGAGGGGGTAGGG + Intergenic
1111330359 13:86757767-86757789 GGTTAGTGGGAGAGGCTGTAAGG + Intergenic
1112116683 13:96363247-96363269 CATCAATGGGAGTGGGTGAAGGG + Intronic
1112377872 13:98860663-98860685 GAGGCGTGGGTGAGGGTGGAGGG + Intronic
1112973070 13:105284658-105284680 GATGAGTGGGAAAGTGAGGAGGG - Intergenic
1113087959 13:106587187-106587209 GATCAGATATAGAGGGTGGAGGG - Intergenic
1113735913 13:112679011-112679033 CATCAGAGGGAGACTGTGGAGGG + Intronic
1114171761 14:20279947-20279969 GATCAGTGTGGGTGGATGGATGG + Intronic
1114198934 14:20505337-20505359 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1114971609 14:28036686-28036708 TCTCAGTGGGAGCGGGTGGGAGG + Intergenic
1115059071 14:29168637-29168659 GCTCAGGGAGAGAGGGTGAAGGG + Intergenic
1115703911 14:35978605-35978627 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1115894473 14:38070196-38070218 GATATATGGCAGAGGGTGGAGGG + Intergenic
1117003204 14:51392812-51392834 GATCATTGGAGAAGGGTGGAAGG + Intergenic
1117404380 14:55387606-55387628 GCTCAGTGAAAGAGGGTGGGAGG - Intronic
1118736477 14:68704916-68704938 GATCAGTGGAGGAGTCTGGAGGG + Intronic
1119408599 14:74413981-74414003 GACCAGAAGGAGAGGGTGGCAGG + Intronic
1119577960 14:75745100-75745122 CATCACTGGCAGAGAGTGGACGG - Exonic
1119733291 14:76964804-76964826 GACCACTTGGAGAGGGTGGGTGG + Intergenic
1119768693 14:77206630-77206652 GATGGGGAGGAGAGGGTGGAGGG - Intronic
1121045394 14:90784166-90784188 GATCAGCAGGAGAGAGTGAAGGG - Intronic
1121562908 14:94887670-94887692 GCTCAGTGGGAGCTGGGGGAGGG + Intergenic
1121974405 14:98389651-98389673 GAGTAGTGGGAGAGGGAGGGAGG - Intergenic
1122367176 14:101201067-101201089 CATGAGTGGAAGAGGCTGGAGGG - Intergenic
1122568707 14:102678175-102678197 CATCAGAGGGAGACCGTGGAAGG + Intronic
1122601024 14:102922074-102922096 GGTGAGTGATAGAGGGTGGATGG - Intergenic
1122822512 14:104354693-104354715 GGGCAGGGGGAGTGGGTGGAGGG + Intergenic
1123673957 15:22690068-22690090 GATGGGTGGGAAAGGGTGGTTGG - Intergenic
1124325962 15:28763056-28763078 GATGGGTGGGAAAGGGTGGTTGG - Intergenic
1124529894 15:30496559-30496581 GCTCAATAGTAGAGGGTGGAGGG + Intergenic
1124768765 15:32511129-32511151 GCTCAATAGTAGAGGGTGGAGGG - Intergenic
1125352309 15:38780846-38780868 GATCAGTGGGAAAGGGGAGGAGG - Intergenic
1125638939 15:41213596-41213618 GCTGAGTGGGAGGAGGTGGAGGG - Intronic
1126295205 15:47131773-47131795 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1126526893 15:49666241-49666263 TATCAGTGGGGGAGGGTAGGAGG - Intergenic
1127584089 15:60365872-60365894 CATCAGAGGGAGACCGTGGAGGG - Intronic
1127638227 15:60891324-60891346 GTGCAGTGGGAGAGGGTGAAAGG + Intronic
1127797004 15:62447340-62447362 GCACAGTGGGAGAGGCTGGGAGG + Intronic
1128280566 15:66390783-66390805 GATTGGTGGGAGGGGGTGGTGGG - Intronic
1128471490 15:67957397-67957419 GACCAGTGGGAGAGGGCAGTTGG + Intergenic
1128651125 15:69414494-69414516 GAGCAGGGAGAGAGGGCGGACGG + Intronic
1128666568 15:69542517-69542539 GGGCAGAGCGAGAGGGTGGAAGG + Intergenic
1128675079 15:69602600-69602622 TAGCAGAGAGAGAGGGTGGAGGG - Intergenic
1130063252 15:80584475-80584497 GCACAGTGGGAAAGGGTGCAGGG + Intronic
1131090963 15:89624758-89624780 TATCAGTGGAAGAGGGTGAGGGG + Exonic
1131232597 15:90670564-90670586 GCTCAATGGGAGGGGCTGGAGGG + Intergenic
1131259774 15:90882328-90882350 GAGCTGGGGGACAGGGTGGAGGG - Exonic
1131387269 15:92017995-92018017 GATGAGTGGAGGAGGATGGATGG + Intronic
1132592253 16:731144-731166 GAACGGAGAGAGAGGGTGGAAGG + Intronic
1132612703 16:825190-825212 GGTCTGTGGGGGAGGGAGGAAGG - Intergenic
1132843244 16:1988683-1988705 GGTCAGAGGGAGAGAGAGGAGGG + Intergenic
1132865667 16:2091614-2091636 GGTCAGTAGGAGCGGGTGGCAGG + Intronic
1133383163 16:5347898-5347920 GATGGGGGGGAGGGGGTGGATGG - Intergenic
1133725579 16:8534420-8534442 GAGAAGTGGGAGCAGGTGGAGGG + Intergenic
1134122798 16:11596693-11596715 GAGCAGGGGGAGAGGGAGGAGGG + Intronic
1135627174 16:24006076-24006098 GATAAGTGAGAGAGGGAAGAAGG - Intronic
1135694706 16:24575793-24575815 GAGGAGAGGGAGAGGGAGGAGGG + Intergenic
1135694758 16:24575915-24575937 GAGGAGAGGGAGAGGGAGGAGGG + Intergenic
1135733846 16:24915556-24915578 GATAAGAGGGAGAGAGTGCAGGG - Intergenic
1135892127 16:26366665-26366687 AAGCAGAGGGAGAGGGAGGAGGG + Intergenic
1136571961 16:31103654-31103676 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1136769728 16:32825715-32825737 GTGGGGTGGGAGAGGGTGGAGGG + Intergenic
1136798370 16:33045438-33045460 GTGGGGTGGGAGAGGGTGGAGGG - Intergenic
1137912310 16:52390425-52390447 GATCAGGAGGGGAGGGCGGAGGG + Intergenic
1138439743 16:57026862-57026884 GGTCAGTGGGAAATTGTGGAAGG - Exonic
1138449650 16:57086036-57086058 GAAGAGTGGGAGAGGGGCGAGGG - Intergenic
1138471601 16:57242678-57242700 GATCAGTGGAACACAGTGGAAGG + Intergenic
1138594896 16:58024785-58024807 GGTCAGTGGGTGAGGGTTGCAGG - Intergenic
1139255425 16:65536609-65536631 GAAGAGTGGGAGAGGGATGAGGG - Intergenic
1139482706 16:67239366-67239388 GAGCAGCGGGAGATGCTGGAGGG - Exonic
1139556166 16:67712309-67712331 CATCAGAGGGAGACCGTGGAGGG - Intronic
1139864026 16:70050350-70050372 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1139966108 16:70746350-70746372 CATGAGTGGGAGAGGGATGAAGG - Intronic
1140067687 16:71625385-71625407 GATGGGTGGGTGAGAGTGGATGG + Intergenic
1140697762 16:77551817-77551839 GAAGAGAGGGAGAGGGTGGGAGG + Intergenic
1141171406 16:81693954-81693976 GCTCAGGGGCAGAAGGTGGAAGG - Intronic
1141421580 16:83921210-83921232 GATGGGTGGTAGAGGGTGGATGG + Exonic
1141514578 16:84535154-84535176 GAGGAGTGGGAGAAGGAGGAGGG - Intronic
1141641984 16:85346802-85346824 GATGAGTGGTAGATGGTGGATGG + Intergenic
1142404940 16:89883222-89883244 GGTCAGTGCGAGACGCTGGACGG - Intronic
1203072145 16_KI270728v1_random:1087820-1087842 GTGGGGTGGGAGAGGGTGGAGGG + Intergenic
1142641993 17:1289605-1289627 GAGGAGTGGGAGAGGGTGGGAGG - Intronic
1142697338 17:1640690-1640712 GAACAGTGGGGGTGGATGGATGG + Intronic
1142818397 17:2446633-2446655 CATCAGAGGGAGACCGTGGAAGG - Intronic
1142851971 17:2708737-2708759 GGTCAGTGGGAGCGGGTCCATGG - Intronic
1143165523 17:4895504-4895526 GGTGAGTGGGGGAGGGAGGAGGG + Intronic
1143246300 17:5488307-5488329 GAACAGAAAGAGAGGGTGGAGGG + Exonic
1143524945 17:7466444-7466466 AAGCAGGGGGAGAGGCTGGAGGG + Exonic
1143900885 17:10173911-10173933 GAGCACAGGGAGACGGTGGAGGG + Intronic
1144717855 17:17446801-17446823 GATCAGTGTGAGAGGAAGAAAGG - Intergenic
1144971153 17:19110791-19110813 GTTCAGTAGGAGAGACTGGAAGG - Intergenic
1144991455 17:19236954-19236976 GTTCAGTAGGAGAGACTGGAAGG - Intronic
1145973850 17:28972890-28972912 GAGCACTGGGAGAAGGAGGAAGG + Intronic
1146216591 17:30981332-30981354 CATCAGAGGGAGACCGTGGAGGG + Intronic
1146444673 17:32923793-32923815 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1146501414 17:33368150-33368172 GATCAATGGGATACAGTGGAAGG + Intronic
1147005130 17:37396771-37396793 TATCAGTGGGATGGGGAGGAAGG - Intronic
1147119157 17:38325461-38325483 GAGGGGTGGGGGAGGGTGGATGG + Intergenic
1147142143 17:38466007-38466029 CATAAGTGGGTGGGGGTGGAAGG - Intronic
1147192472 17:38746157-38746179 GAGAGGTGGGAGAGGGAGGAAGG - Intronic
1147264765 17:39227895-39227917 GTCCAGTGGGAGATGGGGGAAGG - Intergenic
1148076203 17:44936435-44936457 AGTCATTGGGAGTGGGTGGAGGG - Intronic
1148152063 17:45402816-45402838 CCTCTGTGGGAGAGGGAGGAAGG + Exonic
1148691396 17:49528965-49528987 GAGAAGTGTGAGAGGGTGGCAGG - Intergenic
1148812114 17:50300024-50300046 AATTACTGGGTGAGGGTGGAGGG - Intergenic
1148865109 17:50624252-50624274 GATGAGGGGGAGAGAGTGGAAGG + Intronic
1149410408 17:56399618-56399640 GAAGAGTGGGAGAGGGGCGAGGG - Intronic
1150410442 17:64937124-64937146 CCTCTGTGGGAGAGGGAGGAAGG - Intergenic
1151713864 17:75821652-75821674 GATTAGTGGGAAAGGGAGCAAGG + Intronic
1151882885 17:76905444-76905466 GATCAGAGGGAGAGAGGGGTAGG + Intronic
1151956699 17:77383692-77383714 GAGGCGTGGGAGAGGGTGCACGG + Intronic
1152019940 17:77775688-77775710 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1152105511 17:78326340-78326362 CAACAATGGGAGAGGGTGGCAGG + Intergenic
1152239586 17:79154485-79154507 GACGAGTGGGGAAGGGTGGATGG + Intronic
1152245159 17:79181645-79181667 CAGCAGTGGCAGAGGGTGGCCGG - Intronic
1152400767 17:80065052-80065074 GAGGAGGGGGAGAGGGAGGAGGG - Intronic
1152730291 17:81966739-81966761 GCGCAGTCGGAGAGGGAGGAAGG + Intergenic
1152926284 17:83089216-83089238 GAGCAGTGGGTAGGGGTGGAGGG - Intronic
1153078941 18:1197797-1197819 GATCAGGGAGGGAGGGTGGGTGG + Intergenic
1153987778 18:10368551-10368573 GAGGAGAGGGAGAGGGAGGAAGG + Intergenic
1154111114 18:11569318-11569340 TACCAGTGGGAGATGGTGGAAGG - Intergenic
1155079217 18:22391226-22391248 CATCACTGGGAGAATGTGGATGG - Intergenic
1156495481 18:37522876-37522898 GTTTCATGGGAGAGGGTGGATGG - Intronic
1157131625 18:45012866-45012888 GGTGAGTGGGAGAGGGACGAGGG + Intronic
1157863921 18:51165047-51165069 GAACAATGGAAGAGGGTGGCTGG + Intergenic
1158128713 18:54129157-54129179 GGTCAGTGGGAGAAGCTGCATGG + Intergenic
1158602124 18:58864113-58864135 GGCCAGTGGGAGAGGGGGCACGG - Intronic
1158648954 18:59269662-59269684 GAGGAGTAGGAGTGGGTGGAAGG - Intronic
1158987622 18:62834862-62834884 GAGGAGTGGGAGAGGGTGGGAGG - Intronic
1160006819 18:75074315-75074337 GATGAGTGGGACAGGGAGGCAGG + Intergenic
1160204381 18:76821675-76821697 GATGGGTGGGAGGGGGAGGAGGG + Intronic
1160265287 18:77336500-77336522 GAGCAGTGGGAGGAGGTGGAAGG + Intergenic
1160321434 18:77900004-77900026 GCTCAGCTGGAGAGGGTAGAGGG - Intergenic
1161139763 19:2640190-2640212 GAGAAGGGGGAGAGGGAGGAAGG + Intronic
1161353084 19:3804424-3804446 CATCAGGGAGAGAGGGAGGAAGG + Exonic
1162156008 19:8678420-8678442 GATGAGTGGATGAGGATGGATGG - Intergenic
1162424184 19:10584062-10584084 GATCAATGGCTGAGGGTGGAAGG + Exonic
1162683083 19:12361743-12361765 CATCAGAGGGAGACCGTGGAGGG - Intronic
1163007975 19:14408215-14408237 GATCAGGGAGGGAGGGTGGAGGG - Exonic
1164030355 19:21397754-21397776 GGTCTGTGGGAGAGGCTTGAAGG + Intronic
1164305511 19:24002070-24002092 GCACAGTGGGCGAGAGTGGACGG + Intergenic
1165735123 19:38170831-38170853 GATGAGGGGGACAGGGAGGAGGG + Intronic
1166137341 19:40785808-40785830 GTTCAGTGGGTGAGGGTGGAAGG + Intronic
1166163267 19:40967413-40967435 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1166557060 19:43707285-43707307 GTTCAGAGAGAGAGGGTGGGAGG - Intergenic
1166771179 19:45283452-45283474 GATTAGTAGCTGAGGGTGGAAGG - Intronic
1166884555 19:45952518-45952540 GATTAGGGGGAGGGGGTAGAAGG + Intronic
1166911670 19:46163474-46163496 GAGCAGTGGGAGAGGGAGTATGG + Intergenic
1167281480 19:48571779-48571801 GAGCAGGGGAAGAGGGTGCAGGG + Intronic
1167575486 19:50315638-50315660 GAGCAGTGGGGGGGGGTGGGGGG + Exonic
1167602356 19:50461736-50461758 GACCTGGGCGAGAGGGTGGACGG - Intronic
1167671798 19:50857840-50857862 CAGCAGTGTGAGAGGGTGAAGGG - Intronic
1167924342 19:52810913-52810935 CATCAGAGGGAGACTGTGGAGGG - Intronic
1167937282 19:52919191-52919213 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1167971224 19:53188554-53188576 CATCAGAGGGAGACCGTGGAGGG + Intronic
1168468234 19:56621104-56621126 GATCAGAGAGGGAGGGAGGAGGG - Intronic
1168635481 19:57993024-57993046 TATCAGTGAGAGAGGGAGGCAGG + Intronic
1168706744 19:58474617-58474639 GAGCAGAGGGGGAGGTTGGAGGG - Intronic
925063926 2:914720-914742 AGTCATTGGGAGAGCGTGGAAGG - Intergenic
925064025 2:915151-915173 AGTCATTGGGAGAGCGTGGATGG - Intergenic
925241229 2:2331364-2331386 GATGAGTGGGAGCGTGTGCATGG - Intergenic
925389658 2:3486568-3486590 GAGCAGTGGGCGAGGGTTCAGGG - Intergenic
925403798 2:3592220-3592242 CATCAGAGGGAGACCGTGGAAGG + Intergenic
925644709 2:6023940-6023962 CACCAGAGGGAGAAGGTGGAAGG + Intergenic
926039775 2:9663812-9663834 AATCAGTGGGTGGGGGTGGGTGG - Intergenic
926403107 2:12520368-12520390 TGTCAGTGGGAGAGGGAGGGAGG + Intergenic
926798649 2:16639834-16639856 GATAAGTCAGAGAGGGAGGAGGG + Intronic
928003399 2:27541367-27541389 CATCAGAGGGAGACCGTGGAAGG + Intronic
928005612 2:27558873-27558895 CATCAGAGGGAGACCGTGGAGGG + Intronic
928558278 2:32448623-32448645 CATCAGAGGGAGACCGTGGAAGG + Intronic
928684860 2:33738554-33738576 GACTAGAGGGAAAGGGTGGAAGG - Intergenic
929009671 2:37428536-37428558 GATTTAAGGGAGAGGGTGGAAGG - Intergenic
929059013 2:37904188-37904210 GATCAGAGAGAAAGGGTGGTAGG + Intergenic
929439363 2:41953215-41953237 GGTCAGTGGGAGAGATTGGGAGG + Exonic
929599030 2:43193587-43193609 GGTCAGTGGGATGGGCTGGAGGG - Intergenic
929739360 2:44587499-44587521 CATCAGAGGGAGACCGTGGAAGG - Intronic
929835293 2:45391001-45391023 GATCAGGGGCAGAGGTAGGACGG + Intronic
930090825 2:47530184-47530206 GAGGAGTGGGAGATGGGGGAGGG + Intronic
931382510 2:61766671-61766693 TATCAGTGGGAGGGTGTGTAAGG + Intergenic
931774270 2:65526723-65526745 GATGATTGGGAGAGGGAGGGTGG + Intergenic
932766712 2:74475147-74475169 GATAAGTGGGAGAGGCAGGAGGG - Intronic
935277627 2:101489000-101489022 GTTCAGGGGGAGTGGGTGAACGG - Intergenic
935630991 2:105211888-105211910 CATCAGAGGGAGACCGTGGAAGG + Intergenic
936254900 2:110903211-110903233 GACCAGAGGGAGAGGGGAGAAGG + Intronic
937977086 2:127588838-127588860 GATGGGTGTGTGAGGGTGGATGG + Intronic
938533632 2:132220387-132220409 CATCAGAGGGAGACCGTGGAAGG - Intronic
938722502 2:134079010-134079032 GGTCAGCAGGGGAGGGTGGAGGG + Intergenic
939059627 2:137404856-137404878 GAACAGTGGGAGGGGGGTGAGGG + Intronic
939355358 2:141094597-141094619 GGTCAGTGGGAAAGGTTGAATGG - Intronic
939554253 2:143655253-143655275 GAAGAGTGGGAGGGGGTCGAGGG - Intronic
939994793 2:148909858-148909880 GATAAGTAGGAGAGGCAGGAGGG - Intronic
940025999 2:149209080-149209102 GCTTAGTGGGAGATGGAGGAAGG + Intronic
940599743 2:155843975-155843997 CATGAGTGGGAGAGTGAGGAAGG + Intergenic
940618209 2:156078381-156078403 GAAGAGTGGGAGAGGGGTGAGGG - Intergenic
940643095 2:156367584-156367606 CATCAGAGGGAGACCGTGGAGGG - Intergenic
941863722 2:170311932-170311954 GATCAATGGGATAGAATGGAGGG - Intronic
942937431 2:181575115-181575137 CATCAGTGGGAGAAGGGAGAAGG - Intronic
943740185 2:191399238-191399260 CATCAGAGGGAGACCGTGGAAGG + Intronic
945232781 2:207609821-207609843 CATCAGAGGGAGACCGTGGAGGG - Exonic
945834426 2:214822085-214822107 GGTCAGAGAGAGAGGGTGGTTGG + Intergenic
945835983 2:214836327-214836349 CATCAGAGGGAGACCGTGGAGGG + Intergenic
948091780 2:235301718-235301740 GATGAGGGGGAGAAGGGGGAAGG - Intergenic
948830481 2:240596169-240596191 GGTCCCTGAGAGAGGGTGGAGGG + Intronic
1169085497 20:2823089-2823111 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1170044633 20:12072253-12072275 GGTCAGAGGCAGAGGCTGGAGGG + Intergenic
1170262904 20:14431289-14431311 GATAAGTGGCAGAGGTGGGATGG + Intronic
1170603430 20:17859122-17859144 GGGCTGTGGGTGAGGGTGGATGG - Intergenic
1170797734 20:19564204-19564226 GAAAAGTGGGAGAGGGTAAAAGG + Intronic
1171248880 20:23634123-23634145 GATCAGCGGGGGTGGGTGGAGGG - Intronic
1172080383 20:32335993-32336015 GAGAAGTGGGACTGGGTGGAAGG + Intergenic
1172245468 20:33442929-33442951 CACCAGTGGGACAGGGAGGAGGG - Intronic
1172525292 20:35597339-35597361 GATCAGTGGGGGAGGAAGCAGGG - Intergenic
1172896623 20:38304726-38304748 GGTCAGAGGGAGAGTGTGGGAGG + Intronic
1173022701 20:39281370-39281392 GATAATTGGGACAGGGAGGATGG - Intergenic
1173819437 20:46011082-46011104 GATGAGTGGGAGAGAATGAAGGG - Intronic
1174193192 20:48754697-48754719 GATGAGTGGGGGTGGGTGGGGGG + Intronic
1174293765 20:49528903-49528925 GAGCAGTGGGAATTGGTGGAAGG + Intronic
1174568371 20:51483594-51483616 GGTGGGGGGGAGAGGGTGGAAGG - Intronic
1174671947 20:52316631-52316653 GATGAGAGGGAAAAGGTGGAGGG + Intergenic
1174729781 20:52904580-52904602 AAACATTGGGAGAGGGAGGAGGG + Intergenic
1175056275 20:56201496-56201518 CATCATGGGGAGAGGGAGGAAGG + Intergenic
1175766161 20:61594240-61594262 GAGCAGGGGAAGAGGGTGGGGGG + Intronic
1175825848 20:61936314-61936336 GAGGTGTGGGAGAGGGTGGGGGG - Intronic
1176361422 21:5999863-5999885 GATCTGTGGGAGAGCAGGGAAGG + Intergenic
1176654103 21:9574553-9574575 GAGCAGAGGGAGCGGGTGGCTGG - Intergenic
1177981606 21:27922029-27922051 GAAAAGTGGGAGAGGGGCGAGGG - Intergenic
1178024422 21:28449980-28450002 GATCAATGGCAGAGGGAGAAAGG - Intergenic
1178512621 21:33218480-33218502 GACCAGTTAGAGAAGGTGGAAGG - Intergenic
1179017249 21:37604822-37604844 GCTGAGTGGGAGGGGTTGGATGG - Intergenic
1179474343 21:41633697-41633719 GATCAATGTGAGTGGATGGATGG - Intergenic
1179762096 21:43538687-43538709 GATCTGTGGGAGAGCAGGGAAGG - Intronic
1179949702 21:44702837-44702859 CAGCAGTGGGAGAGGTTGGGGGG - Intronic
1181585944 22:23853838-23853860 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1181714077 22:24711706-24711728 GAGCAGTGGGAGATGGAGGTGGG + Intergenic
1182243181 22:28933791-28933813 GATGAGGGGGAGGGGGAGGAGGG - Intronic
1182362374 22:29754300-29754322 GGTCCCTGGGAGTGGGTGGATGG - Intronic
1182381007 22:29887702-29887724 GAGCAGTGGTAGAAGGTGGTAGG + Intronic
1182538722 22:31026313-31026335 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1182729725 22:32478144-32478166 GAACAGTGAGAGAGGATGGATGG + Intronic
1183056698 22:35311127-35311149 GGTGAGTGGGAGTGGGAGGAAGG + Intronic
1183176598 22:36229045-36229067 AAGCAGTGGGTGAGTGTGGAAGG - Intronic
1183590175 22:38775450-38775472 AGTCAGTGTGAGAAGGTGGAGGG - Intronic
1183653551 22:39172262-39172284 CTGCAGTGGGAGATGGTGGATGG + Intergenic
1184201197 22:42971109-42971131 CATCAGAGGGAGACCGTGGAGGG - Intronic
1184202453 22:42980510-42980532 CATCAGAGGGAGACCGTGGAGGG - Intronic
1185070185 22:48651815-48651837 GGTCGGTGCGGGAGGGTGGAGGG + Intronic
949341206 3:3032912-3032934 CATCGGTAGGAGAGGGTGGCAGG + Intronic
950289074 3:11769029-11769051 GAGCAGAGACAGAGGGTGGAGGG + Intergenic
950419999 3:12892883-12892905 GCACAATGGGAGAGGGTGGAGGG - Intergenic
950645951 3:14376928-14376950 CAACAGTGGGAGGGGGTGGGTGG - Intergenic
951313999 3:21165821-21165843 CATCTGTGGGGGAGAGTGGAAGG + Intergenic
952416094 3:33092731-33092753 GATGAGTGGGCAAGGCTGGAGGG + Exonic
952535075 3:34300636-34300658 TATGAGTGGGAGAGGAGGGAAGG + Intergenic
952540047 3:34358038-34358060 GGTAAGTGGGACAGGGTGGGTGG + Intergenic
952857734 3:37785937-37785959 GAGGTGTGGGAGAGGCTGGAGGG + Intronic
952980206 3:38727981-38728003 GAGCAGGGGGAGAGGCTGCAGGG - Intronic
953126491 3:40095845-40095867 GACAAGTGGGAGAGGGCAGAGGG - Intronic
953700916 3:45195137-45195159 GAGCAGTGGGGCAGGGTGGGTGG - Intergenic
953823563 3:46230813-46230835 GATCAGAGGGCCAGTGTGGAGGG - Intronic
954399787 3:50312948-50312970 CATCAGAGGGAGACCGTGGAGGG + Intergenic
954464509 3:50646669-50646691 GGTCTGTGGGGAAGGGTGGAGGG + Intronic
954521285 3:51228860-51228882 GAACAATGGAGGAGGGTGGAGGG - Intronic
954930385 3:54276167-54276189 GGGCAGTGGGAGAGGGCGCAGGG - Intronic
954956109 3:54519389-54519411 GAGCACTGTGAGATGGTGGAGGG - Intronic
956462605 3:69486359-69486381 GAGGAGTGGGAGAGGGGCGAGGG - Intronic
956934951 3:74089974-74089996 GAAGAGTGGGAGGGGGTGGCTGG - Intergenic
958739306 3:98049407-98049429 GAGGAGTGTGAGAGGGAGGAAGG + Intergenic
958785429 3:98592948-98592970 GACCGGTGGGAGAGGAAGGAAGG - Exonic
959415920 3:106075761-106075783 CATCAGAGGGAGACCGTGGAGGG + Intergenic
959498989 3:107083920-107083942 GATAAGTGGGAAAAGGAGGAAGG + Intergenic
959562751 3:107801281-107801303 GGTTAGTGGTAGAAGGTGGAAGG + Exonic
959729112 3:109580783-109580805 GAAGAGTGGGAGGGGGTCGAGGG - Intergenic
960283624 3:115802819-115802841 GAGCATTGGGAGATGGGGGAGGG + Exonic
960512314 3:118565635-118565657 GAAGAGTGGGAGAGGGGTGAGGG - Intergenic
960780797 3:121314567-121314589 CATCAGAGGGAGACCGTGGAGGG + Intronic
961036770 3:123647995-123648017 GGTCAGTGGTAGGGAGTGGAAGG - Intronic
961173779 3:124817564-124817586 CCTCAGTGGGAGAGGGTGGAAGG + Intronic
961464566 3:127073336-127073358 GGCCAGTGGGGGTGGGTGGAGGG + Intergenic
962350476 3:134652148-134652170 GATAAGGGTGAGAAGGTGGAGGG - Intronic
962444616 3:135453398-135453420 AGTCAATGGGAGAGAGTGGAGGG - Intergenic
962479595 3:135787046-135787068 GTTGATTGGGAGAGGATGGAGGG + Intergenic
963079260 3:141376079-141376101 GATCAGTGGGTGTGGGTTGATGG - Intronic
963498217 3:146095910-146095932 CATCAGAGGGAGACTGTGGAGGG - Intronic
963911782 3:150821809-150821831 CATCAGAGGGAGACCGTGGACGG + Intergenic
965977189 3:174640450-174640472 GATCAGTGTGTGTGTGTGGAAGG + Intronic
966783686 3:183607362-183607384 CATCAGAGGGAGACCGTGGAAGG - Intergenic
966946717 3:184781946-184781968 GATCAGTTGGAGAAGTGGGAGGG + Intergenic
967298736 3:187991245-187991267 GATTAGTCAGAGAGGGTGGCAGG - Intergenic
967305118 3:188052153-188052175 GGGGAGTGGGAGGGGGTGGAGGG + Intergenic
967525363 3:190486618-190486640 GATAAGTTGTAGGGGGTGGAGGG + Intergenic
968506991 4:975366-975388 CATCAGAGGGAGACCGTGGAAGG - Intronic
968614304 4:1570534-1570556 GAGCAGTGTGAGAGGGAGGCAGG - Intergenic
969480147 4:7442626-7442648 GAGCTGGGGGAGGGGGTGGAGGG - Intronic
970279225 4:14435708-14435730 GATCAGTGGTGCATGGTGGAGGG + Intergenic
970409072 4:15790206-15790228 CATCAGAGGGAGACCGTGGAAGG - Intronic
971098632 4:23436819-23436841 TATCATTGGGAGAGGCTGGAAGG + Intergenic
971185766 4:24374399-24374421 TATCAGAGGGTGGGGGTGGAAGG + Intergenic
972273256 4:37532964-37532986 GAACAGTGGGAGGGGGGCGAGGG + Intronic
972384793 4:38554485-38554507 GAGGAGTGGGAGAGGGGTGAGGG - Intergenic
972653990 4:41048696-41048718 CATCAGAGGGAGACCGTGGAAGG - Intronic
973847911 4:54932032-54932054 CATCAGGAGGAGAGGGAGGAGGG - Intergenic
975553582 4:75637990-75638012 GGTAACTGGGAGAGGCTGGATGG - Intergenic
975685418 4:76916103-76916125 CATCAGAGGGAGACCGTGGAAGG - Intergenic
978408967 4:108408843-108408865 CATCAGAGGGAGACCGTGGAAGG - Intergenic
979273574 4:118791548-118791570 CATCAGAGGGAGACCGTGGAGGG - Intronic
980241171 4:130177473-130177495 ACTCAGTGGGTAAGGGTGGAAGG + Intergenic
981256120 4:142661935-142661957 GAAGAGTGGGAGAGGTTGGCCGG + Intronic
981887435 4:149693498-149693520 TATGAGTGGGAAAGGATGGAAGG - Intergenic
982040247 4:151390193-151390215 CATCAGAGGGAGACCGTGGAAGG - Intergenic
982213967 4:153064621-153064643 GCTCAGAGGGAGAGGGTCGTGGG - Intergenic
982537499 4:156625300-156625322 GATCAGTGGGGGTGGGAGGATGG - Intergenic
983350509 4:166581900-166581922 GATCAGAGAGACAGGGAGGAGGG + Intergenic
983800796 4:171927747-171927769 GATCAGTTGGAGATGCTGGGTGG - Intronic
984017037 4:174439172-174439194 GAAGAGTGGGAGGGGGTCGAGGG - Intergenic
984321276 4:178199349-178199371 CATTAGTGGGACAGGCTGGAGGG - Intergenic
984804404 4:183737761-183737783 CATCAGAGGGAGACCGTGGAGGG + Intergenic
985670910 5:1206162-1206184 GAGCAGTGAGAGAGGCTGGCAGG + Intronic
985679129 5:1246818-1246840 GAACAGAGGGAGAGGGAGGAGGG - Intergenic
985909849 5:2870501-2870523 GAGCTGTGGAAGAGAGTGGAGGG + Intergenic
986344132 5:6818681-6818703 GGTGATTGGGAGAGGGTGTAAGG + Intergenic
986359501 5:6962729-6962751 GACCTGTTGGAGTGGGTGGAGGG + Intergenic
986610452 5:9561840-9561862 GATCACTAGGAGTGTGTGGAAGG + Intergenic
986751881 5:10794816-10794838 CATCAGAGTGAGAGGGTGCAGGG - Intergenic
988907533 5:35804560-35804582 GCTCAGTGGGAGGGGAAGGAAGG - Intronic
989205180 5:38802914-38802936 GACCAGTGGGAAAGAGTGAAGGG - Intergenic
989378938 5:40795240-40795262 GAAGAGTGGGAGAGGGGTGAGGG + Intronic
989588164 5:43089091-43089113 CATCAGAGGGAGACCGTGGAAGG + Intronic
991375248 5:65958593-65958615 CATCAGAGGGAGACCGTGGAAGG + Intronic
994815128 5:104576250-104576272 GAACAGGGAGAGAGGGAGGAGGG - Intergenic
995754364 5:115486833-115486855 GATCAGGGGAAGGGGCTGGAGGG - Intergenic
995939107 5:117557156-117557178 AATGAGTGGGAAAGGCTGGAAGG - Intergenic
996437198 5:123447786-123447808 TATCATTGGGAGAAGCTGGATGG - Intergenic
996586418 5:125092826-125092848 TGTCAGTGGGGGAGGGGGGAAGG + Intergenic
998216564 5:140242104-140242126 GCTCAGAGGGAGAGGATGAATGG - Intronic
998337260 5:141384244-141384266 GATGAGTGGGGGAAGGTGGGTGG - Exonic
998471982 5:142390515-142390537 GGAGAGAGGGAGAGGGTGGAGGG + Intergenic
998981022 5:147702294-147702316 GACTAGGGGGAAAGGGTGGAAGG + Intronic
1001382576 5:171314157-171314179 GGCCTGTGGGGGAGGGTGGAGGG - Intergenic
1001858048 5:175029734-175029756 GATCAGAGGGAGAGAGAGGTAGG + Intergenic
1002028364 5:176410979-176411001 GAGCTGCGGGAGAGAGTGGAGGG - Intronic
1002197468 5:177509223-177509245 CAGGAGTGGGAGAGGGTCGAAGG - Intronic
1002791436 6:440688-440710 GATGGGTGGGAGAGGATGGAAGG - Intergenic
1003308096 6:4946823-4946845 GGTCAGTGCCAGAGGGAGGAGGG - Intronic
1003380527 6:5620790-5620812 GATCAGAGGCAGTTGGTGGATGG + Intronic
1003395357 6:5748206-5748228 TACCAGTGGGAAAGGGTGAAGGG - Intronic
1003721949 6:8713337-8713359 GATCAGAGCTAGATGGTGGAGGG + Intergenic
1004679065 6:17874756-17874778 GAAGAGTGGGAGAGGGGCGAGGG - Intronic
1006135325 6:31892471-31892493 GAGGAGTGGGAGACGGTGGTGGG - Exonic
1006316077 6:33292595-33292617 GTTCAGTGGCTGAGGGTAGAAGG - Intronic
1006387053 6:33737123-33737145 GAGGAGTGGGAGGGGGAGGAGGG - Intronic
1007095090 6:39208062-39208084 GCACAGGGGGAGAGGGAGGAGGG - Intronic
1008480531 6:51981369-51981391 CATCAGAGGGAGACCGTGGAGGG - Intronic
1009383949 6:63066990-63067012 GAAGAGTGGGAGGGGGTAGAGGG - Intergenic
1009608250 6:65902393-65902415 CATCAATGGGAGAGTGAGGATGG - Intergenic
1010155078 6:72783128-72783150 TATGAGTGGGAGAGGATGAATGG + Intronic
1010367152 6:75064606-75064628 GATGAATGAGAGAGTGTGGAGGG - Intergenic
1010970817 6:82261376-82261398 GAGGAGTGGGTGGGGGTGGAGGG - Intergenic
1011904102 6:92339377-92339399 GACCAGTGGGAGAGGCTGGCAGG + Intergenic
1012077983 6:94717993-94718015 GATCATTGGAACAGGGTGGAAGG + Intergenic
1013268456 6:108523154-108523176 GACCAGTGAGAGAGTGTGGGCGG + Exonic
1013601574 6:111710112-111710134 GCTGGGCGGGAGAGGGTGGAGGG - Intronic
1014650473 6:124030281-124030303 GATCAGTGGGGGTGTGAGGATGG - Intronic
1014988791 6:128048141-128048163 AATCACTGGCAGAGGGTGAATGG + Intronic
1016075324 6:139788724-139788746 TGTCAGTGGGAGGGGGTGGTGGG + Intergenic
1016440927 6:144082618-144082640 GATAAGTGGGTGTGGGGGGAGGG + Intergenic
1016501167 6:144722400-144722422 GATGAGTGGGAGAGGATGGTGGG - Intronic
1017131102 6:151108908-151108930 GATCAGTGGGTGGGGGTCGGAGG + Intergenic
1018602875 6:165563985-165564007 GATCAGTGGGAGAGGGTGGAGGG - Intronic
1018697945 6:166405395-166405417 GCTCAGGGGGTGAGGGTGGGAGG - Intergenic
1018735206 6:166682567-166682589 GAACAGAGTGAGAGGGAGGAGGG + Intronic
1019015191 6:168875186-168875208 GAGCAGGGGTAGAGGATGGAGGG + Intergenic
1019057833 6:169235898-169235920 GGACAGAGGGAGAGTGTGGATGG - Intronic
1019459303 7:1147934-1147956 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1019548856 7:1592364-1592386 CAACAGTGGGAGTGGGTGGTGGG + Intergenic
1019595331 7:1855782-1855804 GGGGAGTGGGAGAGGCTGGAAGG - Intronic
1019715176 7:2535260-2535282 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1019730068 7:2624639-2624661 GAGCAGTGGGAGAGGGTATCTGG - Intergenic
1021735151 7:23635906-23635928 CATCAGAGGGAGACCGTGGAAGG - Intronic
1022088366 7:27090719-27090741 GTTGAGTGGGAAAGGGGGGAGGG - Intergenic
1022238674 7:28488146-28488168 GATCAGAGGGAAAGGGAGGAAGG - Intronic
1022536107 7:31099594-31099616 GAGGAGAGGGAGAGGGTAGAGGG + Intronic
1023239069 7:38123021-38123043 GAGCAGTGGGAGGGGCTGGTAGG + Intergenic
1023278995 7:38550681-38550703 GAGTGGTGGGAGAGGGAGGAGGG - Intronic
1023624404 7:42101827-42101849 GTGGGGTGGGAGAGGGTGGAGGG - Intronic
1023797802 7:43808272-43808294 GTTCAGAGGGAGAAGGTGGCTGG - Intergenic
1025280454 7:57623227-57623249 GAGCAGAGGGAGTGGGTGGCTGG - Intergenic
1025304277 7:57842280-57842302 GAGCAGAGGGAGTGGGTGGCTGG + Intergenic
1025979687 7:66395044-66395066 CATCAGAGGGAGACCGTGGAGGG + Intronic
1026457783 7:70587940-70587962 GTTCAGTGTGAGGGTGTGGAGGG - Intronic
1026904661 7:74056216-74056238 GCTCAGTGAGAGAGGCTGGGCGG - Intronic
1027344599 7:77244779-77244801 GGTCAGTGGGAGGGTGTGGAGGG - Intronic
1028371098 7:90093160-90093182 GAACAGGGAGAGAGGGAGGATGG + Intergenic
1030672215 7:112350176-112350198 GACCAATGGGAGTGGGTGAATGG - Intergenic
1031145074 7:117988693-117988715 TAATAGTTGGAGAGGGTGGAGGG + Intergenic
1032063725 7:128747555-128747577 GCTCAGTGGGGGAGGGTGGGAGG - Exonic
1032902709 7:136328690-136328712 GAACAGTGGGAGAGAGAAGAGGG + Intergenic
1033323597 7:140361572-140361594 CATCAGAGGGAGACCGTGGAAGG - Intronic
1033519362 7:142145411-142145433 GATCAGAGAGAGAGGGAGGAAGG - Intronic
1033628488 7:143133958-143133980 GAAGAGTGGGAGAGGGGTGAGGG - Intronic
1034422322 7:150996294-150996316 GAACAGGGGGAGAGGGAGGAGGG - Intronic
1034456569 7:151174113-151174135 GATCAGTAGGAGTGGCAGGACGG - Intronic
1034961979 7:155368406-155368428 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1037905320 8:22712981-22713003 AAGAAGTGGGAGAGGGTGGTTGG - Intergenic
1037930694 8:22878360-22878382 GCTCTGCGGGAGAGGGTGGAGGG + Intronic
1037963244 8:23115423-23115445 GCTGAGTGGGAGGGGGTGGGTGG + Intronic
1038117988 8:24579242-24579264 TATCAGTGGGTGGGGGTGAAGGG + Intergenic
1038594947 8:28880282-28880304 CATCAGAGGGAGACCGTGGAGGG - Intronic
1038721335 8:30038583-30038605 GAACAGAGGGAGAGGGAGGGAGG + Intergenic
1038745043 8:30247855-30247877 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1038780303 8:30564323-30564345 AATCACTGGGAGAGTGTGCAGGG + Intronic
1039854273 8:41398893-41398915 GAGTAGAGGGAGATGGTGGATGG + Intergenic
1040070180 8:43181065-43181087 CATCAGAGGGAGACCGTGGAGGG + Intronic
1040092068 8:43408794-43408816 TATGAGTGGGAGGGGGTGGCTGG + Intergenic
1040818482 8:51533517-51533539 CATCAGAGGGAGACCGTGGAGGG - Intronic
1041267040 8:56075290-56075312 GAGCAGTGGGAGAGAGCGCAGGG + Intergenic
1041686155 8:60646578-60646600 GGGCAGTGGGAGAAGGGGGAGGG - Intergenic
1043477410 8:80619001-80619023 AATCAGAGGAAGGGGGTGGAGGG - Intergenic
1043744358 8:83855075-83855097 GAGCAGGGAGAGAGGGAGGAAGG + Intergenic
1044530193 8:93299021-93299043 GATCATGGGGACAGGGTGTATGG + Intergenic
1045120610 8:99029748-99029770 CATCAGAGGGAGACCGTGGAAGG + Intronic
1045380781 8:101622826-101622848 GAAAAGTGGGAGGGGGTTGAGGG - Intronic
1046636106 8:116678013-116678035 CATCAGAGGGAGACCGTGGAAGG - Intronic
1047167217 8:122452495-122452517 GAACAGAGCGAGAGAGTGGAAGG + Intergenic
1047206564 8:122806993-122807015 GCTCACTGGTAGAGGGTGGAGGG + Intronic
1047221942 8:122925860-122925882 GATCACAGGGACAGAGTGGAAGG + Intronic
1048940090 8:139392935-139392957 GACCAGCTGGAGAGGGTGCATGG - Intergenic
1049098344 8:140561974-140561996 GATTGCTGGGAGAGGGTGTAGGG - Intronic
1049799704 8:144512093-144512115 GATCACTGCGGGAGGGTGGATGG + Intronic
1050353420 9:4761491-4761513 GAGCAGTGTGGGAGGCTGGAAGG - Intergenic
1050572028 9:6949814-6949836 CATCAGAGGGAGACCGTGGAGGG + Intronic
1050601756 9:7259833-7259855 GATGAGTGGGGAAGGGTTGAGGG + Intergenic
1050778691 9:9302527-9302549 GAAAAGTGGGAGAGTGGGGAAGG - Intronic
1051070987 9:13166763-13166785 AATCAGTGGGAGAGGGGAAACGG + Intronic
1051683253 9:19629854-19629876 CTTCAGTGGGAGAGTGTGAATGG + Intronic
1053056329 9:34995017-34995039 GCTCAGTGAGAGAGGGAGGGAGG - Intronic
1053828135 9:42047611-42047633 GAGGAGTGGGAGAGGGTAGTGGG - Intronic
1054880192 9:70136521-70136543 GATGTGTGGGAGGGGGTGGAAGG - Intronic
1056698534 9:88881324-88881346 GAAGAGTGGGAGAGGGGTGAGGG - Intergenic
1057262032 9:93590403-93590425 CAGGAGTGGGAGAGAGTGGAAGG - Intronic
1057404656 9:94758078-94758100 GTTCAGTGGGGGAGGGAGCAAGG + Intronic
1058128239 9:101221232-101221254 GAAGAGTGGGAGAGGGGTGAGGG - Intronic
1058817002 9:108693657-108693679 GATTAGGGGGAAAGGGAGGAAGG + Intergenic
1059140842 9:111851794-111851816 GCCCAGGGGGAGAGAGTGGATGG - Intergenic
1060116131 9:120942493-120942515 GGTATGTGGGAGAGGGGGGAGGG + Intergenic
1060482460 9:124024948-124024970 GTACAGTGGGAGAGGAGGGAAGG + Intronic
1061249345 9:129417354-129417376 AGTCACTGGGAGAGGATGGATGG - Intergenic
1062103873 9:134742146-134742168 GAGCAGCGGGAGAGTGTGCAGGG - Intronic
1062147368 9:134997096-134997118 GGTGAGTGGGAGAGTGTGGAGGG + Intergenic
1062207088 9:135343183-135343205 GCTCAGTGGGACCTGGTGGAGGG - Intergenic
1062369773 9:136231914-136231936 GAGGAGGCGGAGAGGGTGGAGGG - Intronic
1062371661 9:136242398-136242420 GACCAGTGGGAGAAGGCGGCTGG + Intronic
1203631825 Un_KI270750v1:78011-78033 GAGCAGAGGGAGCGGGTGGCTGG - Intergenic
1185497460 X:566188-566210 GATAAATGGGAATGGGTGGATGG + Intergenic
1186191207 X:7069130-7069152 GAGCAGTGGATGAGGGCGGATGG + Intronic
1186250419 X:7660162-7660184 AAGCAGGGGGAGAGGGAGGAAGG + Intergenic
1186414428 X:9370772-9370794 ATTCAGTGGGAGAGGATGGCCGG + Intergenic
1188368141 X:29335235-29335257 CATCAGAGGGAGACCGTGGAGGG + Intronic
1189360617 X:40347942-40347964 GAACAGTGGTAGATGGTTGAGGG + Intergenic
1189556831 X:42153656-42153678 GATCAGTGGAGGAGGTTGGTGGG - Intergenic
1189712796 X:43831549-43831571 GATGACTGAGAGAGGGAGGAAGG + Intronic
1189774817 X:44461260-44461282 AACCAATGGGAGAGGGTTGAGGG + Intergenic
1189838235 X:45042224-45042246 CATCAGAGGGAGACCGTGGAAGG + Intronic
1190126455 X:47709686-47709708 CATCAGTGGGGGTGGGTGGATGG + Intergenic
1190508385 X:51152095-51152117 GAACAGTGGGAGAAGTTGGGAGG - Intergenic
1190623614 X:52314032-52314054 GATCAGTGAGAAAAGGAGGAAGG + Intergenic
1191764870 X:64686862-64686884 TATCAGAGTCAGAGGGTGGAGGG + Intergenic
1191954922 X:66633938-66633960 GGTAAATGGGACAGGGTGGAGGG - Intronic
1193568750 X:83114459-83114481 ATTCAGTGGGAGAGAGAGGAAGG + Intergenic
1194326164 X:92519955-92519977 GTCCTGTGGGATAGGGTGGAGGG + Intronic
1194873976 X:99163987-99164009 GAAAAGTGGGAGAGGGTTCAGGG + Intergenic
1195049133 X:101080644-101080666 GGACAGAGGGACAGGGTGGAGGG + Intronic
1197504476 X:127284450-127284472 AAACAGTGGGAGGGGGTTGAGGG + Intergenic
1197666887 X:129233920-129233942 GGTCAGGGGTAGAGGGGGGATGG - Intergenic
1198805152 X:140486843-140486865 GTTCATTTGGGGAGGGTGGAAGG - Intergenic
1199074159 X:143510807-143510829 GATCCGAAGGAGAAGGTGGAGGG - Intronic
1199093153 X:143714068-143714090 GATCCGAAGGAGAAGGTGGAGGG - Intronic
1199215182 X:145254092-145254114 GATCCGAAGGAGAAGGTGGAGGG + Intronic
1199521008 X:148735757-148735779 GAAGAGTGGGAGAGGGGTGAGGG - Intronic
1199655425 X:149990254-149990276 TATCAGTGGGGGAGGGAGAAAGG + Intergenic
1199681704 X:150229243-150229265 AATCATTGGGAGAGGGTAGGAGG - Intergenic
1199704001 X:150408216-150408238 CATCACTGGGAGAGGGTGACTGG + Intronic
1200367906 X:155687125-155687147 GTTCAGTGGGAGAGAAAGGAAGG + Intergenic
1200634883 Y:5639153-5639175 GTCCTGTGGGATAGGGTGGAGGG + Intronic
1201146255 Y:11066994-11067016 GAACAGAGGGAGAGGGAGGAAGG + Intergenic
1201146272 Y:11067047-11067069 GTACAGAGGGAGAGGGAGGAAGG + Intergenic
1201146552 Y:11067931-11067953 GAACAGAGGGAGAGGGAGGAAGG + Intergenic
1201562561 Y:15333455-15333477 GAGCAGTGGATGAGGGCGGATGG + Intergenic