ID: 1018603559

View in Genome Browser
Species Human (GRCh38)
Location 6:165573903-165573925
Sequence ATAAGCCAGGGGTCCCTACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 95
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 85}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018603559_1018603565 23 Left 1018603559 6:165573903-165573925 CCCAGTAGGGACCCCTGGCTTAT 0: 1
1: 0
2: 0
3: 9
4: 85
Right 1018603565 6:165573949-165573971 TCTTATCAGCTTATAGTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018603559 Original CRISPR ATAAGCCAGGGGTCCCTACT GGG (reversed) Intronic
900115132 1:1025070-1025092 CTCAGCCAGGAGTCCCTCCTGGG - Intronic
900408678 1:2503337-2503359 AGGCTCCAGGGGTCCCTACTGGG + Intronic
908264146 1:62361820-62361842 ATAAGCCAGGTATCCCTCCCTGG - Intergenic
1063730528 10:8691822-8691844 AGAATGCAGGGCTCCCTACTCGG - Intergenic
1067971857 10:50980806-50980828 ATTAGTCAGGGTTCCCTAGTGGG - Intergenic
1070097517 10:73352231-73352253 AAAAGCCCTGGTTCCCTACTTGG + Intronic
1076559721 10:131353536-131353558 TGAAGTCAGGGGTCCCTCCTAGG - Intergenic
1081183209 11:40010333-40010355 ATATGCCAGGGCTCCCTACAAGG + Intergenic
1087198780 11:95324961-95324983 ATTAGTCAGGGTTCCCTACAGGG - Intergenic
1090635347 11:128687455-128687477 CTAAGCTTTGGGTCCCTACTCGG - Intronic
1091116681 11:133019765-133019787 ATATGCCAGGGCTTCCTTCTAGG + Intronic
1092997032 12:13960192-13960214 CTAACCCATGGGTCTCTACTGGG - Intronic
1094860554 12:34461526-34461548 ATAAGCCTGGGAACCCTACAGGG + Intergenic
1097013605 12:55970132-55970154 ATTAGCCAGGTGTGGCTACTTGG + Intronic
1099091186 12:78311181-78311203 ATAATCCAGGGCTACCAACTGGG + Intergenic
1101205432 12:102482401-102482423 ATAATCCAGGGCCACCTACTAGG - Intergenic
1102941696 12:116948065-116948087 AGAACCCTGGGGTCCCTTCTAGG - Intronic
1111420111 13:88000318-88000340 CCAAGCCAGGGGTCCCTGCCTGG + Intergenic
1111483214 13:88860068-88860090 TTAGGCCAGGAGTCCCTACTTGG + Intergenic
1114253995 14:20986356-20986378 ATAAGCCAGAGTTTCCTTCTTGG + Intergenic
1122804067 14:104247883-104247905 ATCAGCCCAGGGTCCCTCCTCGG + Intergenic
1124118986 15:26872363-26872385 AGAAGTCAGGAGTCCTTACTCGG + Intronic
1124783788 15:32660163-32660185 AAAAGCCAGAGGTCCTTACCAGG - Intronic
1124953314 15:34343082-34343104 ATAAGCCAGCGGTCCCAATTCGG + Exonic
1133707716 16:8371022-8371044 ATAAGCCAGGGGCTCAAACTTGG - Intergenic
1138657802 16:58500925-58500947 TTCAGGCAGGGGTCCCTGCTGGG + Intronic
1139901498 16:70332063-70332085 AGAAGCCAGGAGTCCTGACTTGG + Intronic
1141290703 16:82715956-82715978 CTAAGCCATGTGTCACTACTGGG + Intronic
1144426889 17:15151617-15151639 AGAAACCAGGGGTCCCTGCTGGG + Intergenic
1145300003 17:21627206-21627228 AAAAGCCAGGAGTTCCTGCTGGG + Intergenic
1146765394 17:35516239-35516261 AAAAGGTTGGGGTCCCTACTAGG + Intronic
1148584734 17:48769329-48769351 ACAGGCCATGGGACCCTACTGGG - Intronic
1149176726 17:53881007-53881029 ATTAGTCAGGGTTCCCTAATGGG + Intergenic
1151972593 17:77466486-77466508 GCGAGCCAGGGGTCACTACTGGG + Intronic
1154128348 18:11714151-11714173 ATATGGCAGGGGTACCTAGTGGG - Intronic
1155666261 18:28312774-28312796 ATAATCCAGTAGTTCCTACTTGG - Intergenic
1156228887 18:35135211-35135233 ATATGCCAGGTGTCCTTATTTGG + Intronic
1156340890 18:36209847-36209869 ATTAGCCAGGTGTCACTACTGGG - Intronic
1159356215 18:67339423-67339445 ATAAGCCAGGGGTCTCTTGATGG + Intergenic
1159991480 18:74913951-74913973 ATAAGGCATGGGTCCCATCTTGG + Intronic
1164986071 19:32649641-32649663 ATCAGCCAGGGTCACCTACTCGG - Intronic
1167464037 19:49640824-49640846 ATGACCCAGGCATCCCTACTTGG - Intergenic
929281055 2:40079243-40079265 AGATGCCAGTGGTCCCTCCTAGG - Intergenic
931373046 2:61682034-61682056 ATATACCAGGGGTGCCTAGTAGG + Intergenic
932855350 2:75228001-75228023 ATTAGCCAGGGTTCCCTAGAGGG + Intergenic
937716953 2:125043149-125043171 ATAAGCCAGGGGTTTCTTTTGGG - Intergenic
946599412 2:221343010-221343032 ATTAGCCAGGGTTCCCTAGAGGG + Intergenic
947436878 2:230080451-230080473 ATAAGCCAGGCTGCCCTCCTGGG - Intergenic
947832567 2:233152136-233152158 ACAAGACAGGGGTTCCTACAGGG + Intronic
1169092932 20:2872526-2872548 AATGTCCAGGGGTCCCTACTGGG + Intronic
1170776232 20:19377049-19377071 ATTTGCCAGGGCTGCCTACTTGG + Intronic
1171900862 20:30854950-30854972 AGAAGCCAGGAATCCCTTCTAGG - Intergenic
1176075625 20:63247098-63247120 ATACGCCAGGGTTCCCGACAAGG + Intronic
1180334231 22:11560937-11560959 AGAAGCCAGGAATCCCTTCTAGG - Intergenic
1180610924 22:17097459-17097481 ATATGTCAGGGGTCTCTAATTGG - Intronic
1182718235 22:32376975-32376997 ATAAGCCAGGGAGCCCTCCCTGG + Intronic
1183298643 22:37047061-37047083 AGAGACCAGAGGTCCCTACTAGG - Intergenic
959020256 3:101181056-101181078 ATCAGCCAGGGTTCACTGCTTGG + Intergenic
962898781 3:139738725-139738747 ATAAGCCAGGGTTCCCTAGAGGG - Intergenic
964549350 3:157869540-157869562 ACAACCCTGGGGTCCCTAATCGG - Intergenic
972125644 4:35761328-35761350 CTAAGCCAGGGGTCCCTGCCTGG - Intergenic
972630213 4:40835920-40835942 ATAACTCTGGGGTCCCTGCTAGG + Intronic
974345763 4:60679209-60679231 ATTAGTCAGGGTTCCCTACAGGG + Intergenic
983724674 4:170905861-170905883 ATTAGTCAGGGTTCCCTACAGGG - Intergenic
986749488 5:10774045-10774067 ACAGGTCAGGGGTCACTACTTGG + Intergenic
990941902 5:61210864-61210886 ATCAGCCAGGGCTCCCTTCCAGG - Intergenic
992337878 5:75791951-75791973 ATTAGCCAGGGTTCCCTAGAGGG + Intergenic
992339031 5:75803147-75803169 ATTAGCCAGGGTTCCCTAGAGGG - Intergenic
997065794 5:130556972-130556994 CTAAGCCAGGGGGCCCTGCATGG - Intergenic
999086743 5:148898802-148898824 ATAAGCCAGGAGACCCAACTAGG + Intergenic
1000260808 5:159586758-159586780 ATAAGCAAGGGATGACTACTTGG + Intergenic
1005857575 6:29874121-29874143 ATAAGCAAGAGGTCACTAGTGGG - Intergenic
1018047076 6:159975031-159975053 ATTGGCCAGGGGTCACTGCTTGG - Intronic
1018309634 6:162494345-162494367 AGAAGCCAGGGTTCCCCACCAGG - Intronic
1018603559 6:165573903-165573925 ATAAGCCAGGGGTCCCTACTGGG - Intronic
1019309372 7:352779-352801 TGGAGCCAGGGGTCCCTACTGGG - Intergenic
1020144061 7:5629326-5629348 ATTAGCCAGGTGTGGCTACTGGG + Intronic
1022440116 7:30426280-30426302 CTAAGCCAGGGGACCCTAGGAGG - Intronic
1029612622 7:101635458-101635480 ATTAGCCAGGGTTCCCTAGAGGG - Intergenic
1030791144 7:113730444-113730466 ATTAGTCAGGGCTCTCTACTGGG - Intergenic
1032987099 7:137349785-137349807 AAAAGCCAGAGGACTCTACTTGG + Intergenic
1033168709 7:139064657-139064679 ATAGGCCAGGTGCCCCTCCTAGG + Intronic
1039580929 8:38666444-38666466 AAAAGCCAGGGCTCCTTTCTGGG - Intergenic
1047548163 8:125839685-125839707 CCAAGCCAGGGGGCCCTACCTGG - Intergenic
1058549934 9:106103838-106103860 ATTAGTCAGGGTTCCCTACAGGG - Intergenic
1059575460 9:115483653-115483675 ATCAGCCAGAGGTCCAGACTAGG + Intergenic
1061094101 9:128444485-128444507 AGCAGCCAGGGGTCCCAAGTCGG + Intergenic
1190322206 X:49186000-49186022 ATAAGAGAGGGGTCCCCACCAGG + Intronic
1190332921 X:49247067-49247089 ATAAGCTAGGGGACCCCTCTGGG - Intronic
1192782738 X:74310305-74310327 ATAAGTCTGGGCTCCCCACTAGG - Intergenic
1193082654 X:77421337-77421359 GGAAGCCCGGGGTCCCCACTGGG - Intergenic
1194661921 X:96637275-96637297 ATAAACCAGGGGCCCATATTTGG - Intergenic
1196462966 X:115948421-115948443 ACAAGCCAGGGTTCCTTAGTGGG - Intergenic
1200010123 X:153114435-153114457 TCAAGCCAGGGGCCCCTCCTTGG + Intergenic
1200029477 X:153285487-153285509 TCAAGCCAGGGGCCCCTCCTTGG - Intergenic