ID: 1018605586

View in Genome Browser
Species Human (GRCh38)
Location 6:165594748-165594770
Sequence GCCAGATGTCTCCACCATAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018605586_1018605589 29 Left 1018605586 6:165594748-165594770 CCTTTATGGTGGAGACATCTGGC No data
Right 1018605589 6:165594800-165594822 TAGCATCACCAAAAATAGAAAGG 0: 1
1: 0
2: 2
3: 23
4: 362

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018605586 Original CRISPR GCCAGATGTCTCCACCATAA AGG (reversed) Intronic