ID: 1018605586 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 6:165594748-165594770 |
| Sequence | GCCAGATGTCTCCACCATAA AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1018605586_1018605589 | 29 | Left | 1018605586 | 6:165594748-165594770 | CCTTTATGGTGGAGACATCTGGC | No data | ||
| Right | 1018605589 | 6:165594800-165594822 | TAGCATCACCAAAAATAGAAAGG | 0: 1 1: 0 2: 2 3: 23 4: 362 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1018605586 | Original CRISPR | GCCAGATGTCTCCACCATAA AGG (reversed) | Intronic | ||