ID: 1018606837

View in Genome Browser
Species Human (GRCh38)
Location 6:165606540-165606562
Sequence TTTGATCAATAGCAGGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 137}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018606837_1018606840 19 Left 1018606837 6:165606540-165606562 CCTTCCACCTGCTATTGATCAAA 0: 1
1: 0
2: 1
3: 12
4: 137
Right 1018606840 6:165606582-165606604 TGCAATCTTACCTCATACCCAGG No data
1018606837_1018606841 22 Left 1018606837 6:165606540-165606562 CCTTCCACCTGCTATTGATCAAA 0: 1
1: 0
2: 1
3: 12
4: 137
Right 1018606841 6:165606585-165606607 AATCTTACCTCATACCCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018606837 Original CRISPR TTTGATCAATAGCAGGTGGA AGG (reversed) Intronic
906790464 1:48654634-48654656 TTTGATAGATGGCAGGAGGAAGG + Intronic
908040899 1:60111706-60111728 TTTGCTTACTATCAGGTGGAGGG + Intergenic
908652710 1:66353540-66353562 TTTCATCTATAGCAAGTTGAAGG - Intronic
915323008 1:155066354-155066376 CTTGATCAATGTCAGGTGGATGG - Intronic
917175021 1:172224494-172224516 TTTGATGAAGATGAGGTGGATGG + Intronic
917668242 1:177246574-177246596 TTTGAGCAATAAAAGTTGGAGGG + Intronic
918938761 1:190961742-190961764 TTTGATGAATAGATGGTTGAGGG - Intergenic
922004723 1:221518295-221518317 TTTGACCAATAGAATGTGGATGG + Intergenic
922209789 1:223478543-223478565 TTTGATTGATAGGAGGAGGAAGG + Intergenic
922341139 1:224656093-224656115 ATTGATCAATAGAAAGGGGAGGG - Intronic
924080039 1:240386424-240386446 TTTGAGTAATATCAGATGGAAGG - Intronic
1063859483 10:10292061-10292083 TTTGATCCATACAAGGTGGGTGG - Intergenic
1068160619 10:53258456-53258478 TCTGATCAATAAGAAGTGGAAGG - Intergenic
1068794872 10:61068488-61068510 TTTGGTCATTAGCAAATGGAAGG + Intergenic
1068831357 10:61498873-61498895 TTTGAACAATAGGAGTAGGAAGG - Intergenic
1070121634 10:73583085-73583107 ATTGATCAATATCAGTTTGAGGG - Intronic
1074859488 10:117499562-117499584 TTTGATAATAAGCAGGTGTAAGG + Intergenic
1074957290 10:118404624-118404646 CTTGATAAATGGAAGGTGGAGGG + Intergenic
1075487562 10:122838018-122838040 TTTGAACAATAGCATGACGAGGG - Intronic
1075572095 10:123553439-123553461 TTTGACCAATAGCCAGTGGCAGG + Intergenic
1076485272 10:130811587-130811609 TTTGACCAATAGAATCTGGAGGG + Intergenic
1080520073 11:33060902-33060924 TTTGTTAAATACCAGGTGGGTGG + Intronic
1081761383 11:45578503-45578525 TTTGGCCAATAGGAGGTGGGTGG - Intergenic
1082646430 11:55732474-55732496 TGTGATGAATAGCATGTGGTAGG + Intergenic
1085759146 11:79226885-79226907 TTTGAACAAAAGCGGGTGGGTGG + Intronic
1087005337 11:93465313-93465335 TCTGTTCAAAAGCAGGTGGCAGG + Intergenic
1087884718 11:103465860-103465882 TTTGACCAATAGAATGTGGTAGG - Intronic
1087920301 11:103859256-103859278 TTCAATCAACAGCAGTTGGATGG - Intergenic
1088970084 11:114766282-114766304 TTTGATTTATAGCAGGTGGAAGG - Intergenic
1089968021 11:122669949-122669971 TTTGATGAACAGCAGAAGGAAGG + Intronic
1090996394 11:131869579-131869601 TTTTAGAAATAGCAGTTGGAAGG - Intronic
1091148221 11:133299797-133299819 TGTGATGAAGAGCAGGTGAACGG + Intronic
1097534605 12:60851101-60851123 TTTGATGAATACCAGTTGTAGGG + Intergenic
1098058605 12:66536032-66536054 TTTGAGCATGAGCAGCTGGAAGG - Intronic
1102662039 12:114537629-114537651 TCTGATGAATTGCAGGCGGATGG - Intergenic
1102665647 12:114570414-114570436 TCTGATGAATTGCAGGTGGATGG + Intergenic
1103493507 12:121342496-121342518 TTTTATTACTAGCAGGTGGAAGG - Intronic
1103555672 12:121764993-121765015 TCTGATGAATGGCAGATGGAGGG - Intronic
1109888968 13:68581979-68582001 TTTAAATAATAGCAGGTAGATGG + Intergenic
1111642963 13:90994155-90994177 TTTGATGAATATCAGGTCCATGG + Intergenic
1111777180 13:92679119-92679141 TTTGATCATTAGCATGGGGCTGG + Intronic
1111909720 13:94297287-94297309 TTTGTTGAATCGTAGGTGGAAGG + Intronic
1112724044 13:102281529-102281551 TTTGATCATTAGGAGGTTGTTGG - Intronic
1113188572 13:107717985-107718007 CTGGAACAACAGCAGGTGGAGGG - Intronic
1116739030 14:48731670-48731692 TTTGATCAATAGCAGCAAGTGGG + Intergenic
1119766785 14:77195543-77195565 TTTGCTAAAATGCAGGTGGAAGG - Intronic
1123738027 15:23204279-23204301 TTTGATTCAGAGCAGGTGGTTGG + Intergenic
1124514993 15:30360341-30360363 GTTCATCCATAGCATGTGGAAGG + Intergenic
1124727929 15:32170386-32170408 GTTCATCCATAGCATGTGGAAGG - Intronic
1124972374 15:34500775-34500797 TTTGATCATTAGCATGGGGCTGG + Intergenic
1127097441 15:55527010-55527032 CTTGGTGAATAGCAGGGGGATGG + Intergenic
1128878135 15:71218884-71218906 TTTAATAAATATCTGGTGGAAGG - Intronic
1131569961 15:93524655-93524677 CTACATCAAGAGCAGGTGGATGG - Intergenic
1136926448 16:34379737-34379759 TTTGATAAGTAGAAGGAGGAGGG - Intergenic
1136978126 16:35032070-35032092 TTTGATAAGTAGAAGGAGGAGGG + Intergenic
1139168954 16:64607243-64607265 AATGATCAATAGCAGGTAAATGG - Intergenic
1141187100 16:81795866-81795888 TCTGTTCAATAGAAGGTGGGAGG - Intronic
1141588000 16:85047885-85047907 ATTGACCAGTAGCAGGTAGAAGG - Intronic
1142284100 16:89164746-89164768 TTCAATCAATATCAAGTGGACGG - Intergenic
1146268326 17:31467886-31467908 TTTGCAAAATAGCAAGTGGAAGG + Intronic
1153556956 18:6324534-6324556 TTTGACCAATGGCAGATGCAGGG + Intronic
1159022139 18:63151986-63152008 TTTAATCTATAGCAGTTGGCAGG + Intronic
1159497506 18:69224968-69224990 TTGGAGCAATGGCAGGTGTACGG - Intergenic
1160135414 18:76267113-76267135 TTTGACCTATAGAAGGTGCATGG - Intergenic
1160761683 19:788716-788738 TTTTATCCATGGCAGGTGGAAGG - Intergenic
1161539988 19:4844750-4844772 GTTGATCAGAAGCTGGTGGAAGG - Exonic
932787126 2:74615867-74615889 ATGCATCAATAGCAGGTGGGGGG + Intronic
935043338 2:99455890-99455912 TTTGTGAAAAAGCAGGTGGAGGG - Intronic
935580068 2:104749025-104749047 ATTAATCAAGAGCAGGTGGGTGG + Intergenic
935713898 2:105922911-105922933 TTTTATTAATAGAATGTGGAGGG - Intergenic
935785371 2:106544064-106544086 TTTGGTCAAGAGCACGTGGGTGG + Intergenic
940049380 2:149446107-149446129 ATGGAAGAATAGCAGGTGGATGG + Intronic
941372864 2:164688793-164688815 TTGGTTCAACAGAAGGTGGAGGG - Intronic
948315277 2:237023859-237023881 TTTGAACCACATCAGGTGGATGG - Intergenic
948665383 2:239531556-239531578 TTTGATGCATAGAAGGTGGGAGG + Intergenic
1170447450 20:16443183-16443205 TTTGATTAATACAAGGTGGAAGG - Intronic
1175432767 20:58918395-58918417 TTTAATCAATAGCATGTGAAAGG + Intergenic
1176699495 21:10026475-10026497 GTAGATCAATATAAGGTGGATGG - Intergenic
1178000507 21:28157641-28157663 TCTGGCCAATAGGAGGTGGAGGG - Intergenic
950123109 3:10494960-10494982 TTTCCTCAATAGCAGCTGGCAGG + Intronic
952748236 3:36802347-36802369 TTTGATCTACAGCACCTGGAGGG - Intergenic
955129077 3:56145840-56145862 TTTGATCCAGAGCAGGTAGTTGG - Intronic
955695316 3:61629947-61629969 TTTGTTCAACAGAAGGTGGATGG + Intronic
960517313 3:118616579-118616601 TTTGATCAGTGGCAGGAAGAAGG - Intergenic
961483806 3:127202522-127202544 TTTCATAAACAGCAGGTCGATGG + Intergenic
963277875 3:143350870-143350892 TTTGACTAATAGCAACTGGAGGG - Intronic
964317451 3:155459269-155459291 TTTGATCTATGGCAGGTGGTGGG + Intronic
967448831 3:189598895-189598917 TTTGGAGAATAGCAAGTGGAAGG + Intergenic
967780443 3:193433378-193433400 TTTATTCATTAGAAGGTGGAGGG + Intronic
969550789 4:7865773-7865795 TTTGGTCCAAAGCAGGTGGGAGG + Intronic
971009326 4:22415182-22415204 TTTGATCAAATGCAAGTGGTAGG - Intronic
971059037 4:22946549-22946571 TTTGATCAGTAGCAGCTGAGAGG + Intergenic
978835482 4:113144585-113144607 TTTAATTTATAGCATGTGGATGG + Intronic
979993676 4:127405721-127405743 TTTGAGCAAAAGCAGGAGCAGGG - Intergenic
980329696 4:131394471-131394493 TTTGATCTATAGCAGGTTATTGG - Intergenic
984050226 4:174856633-174856655 TTTGATCTCTAGCATTTGGAGGG + Intronic
984272059 4:177559128-177559150 TTTGTTCTATAGCAGGAGGGGGG - Intergenic
986450727 5:7861740-7861762 ATTGATCAATGCAAGGTGGAAGG - Intronic
988854884 5:35218887-35218909 TTTGATAAGTGGCAGGTGGGTGG + Intronic
990674240 5:58165691-58165713 AGTGATCATTTGCAGGTGGATGG + Intergenic
992217971 5:74544265-74544287 TTTTATTAATAGCAGGAGGCCGG + Intergenic
992773494 5:80070203-80070225 TTTGCTCAATCCCAGGGGGAGGG - Intronic
999030458 5:148284652-148284674 TTTGAACAATAGGAGGAGAAGGG + Intronic
1000881576 5:166703869-166703891 CTTGATCACTTGCAGGAGGATGG + Intergenic
1000998761 5:167985231-167985253 TTTGATCAAAAGCTAGGGGAAGG - Intronic
1001151897 5:169236986-169237008 ATTGAACAATAGATGGTGGATGG - Intronic
1003836922 6:10081255-10081277 CTTGATGAATAGCATGTGGCTGG + Intronic
1003978708 6:11369049-11369071 TTTGCTCAATAGCACATGGCAGG + Intronic
1005395702 6:25379613-25379635 TCTGATCACTAAAAGGTGGATGG + Intronic
1006592495 6:35168817-35168839 TGTGATCAAAAGCCAGTGGAAGG - Intergenic
1008673084 6:53793764-53793786 TTTTAGCTATAGCAGCTGGAGGG + Intergenic
1009047106 6:58245996-58246018 TTTGAACAATATCACGGGGAGGG - Intergenic
1009706004 6:67252886-67252908 TTTAATCAATAGCAGCTGTGAGG + Intergenic
1011435982 6:87337285-87337307 TGTGAATAAAAGCAGGTGGAAGG + Intronic
1015424808 6:133053280-133053302 TTTGAACAATTGCACATGGAAGG + Intergenic
1016226445 6:141745009-141745031 TTTGACCAATAGAATGTGGTGGG + Intergenic
1016783670 6:147987536-147987558 TTTTCTCGATGGCAGGTGGAAGG - Intergenic
1016878056 6:148883264-148883286 TTAGACCAATACCAGGTGGAAGG + Intronic
1017505412 6:155064619-155064641 TTTGAGTAATTCCAGGTGGAGGG + Intronic
1018606837 6:165606540-165606562 TTTGATCAATAGCAGGTGGAAGG - Intronic
1019074919 6:169379383-169379405 TTTACTCATTAGCATGTGGATGG - Intergenic
1019269951 7:141374-141396 CTTGATCAATTTCAGGTGGTGGG + Intergenic
1028432478 7:90763359-90763381 CTTGATCAAGAGTAGGTGAAAGG - Intronic
1033867986 7:145715474-145715496 TTTGTTCAATAGCAATTGAATGG + Intergenic
1034178117 7:149116347-149116369 TTTGTTCACTAACAGGAGGAAGG - Intronic
1034959799 7:155358171-155358193 TTTCATCATTCGCAGGAGGATGG + Exonic
1037607391 8:20449166-20449188 AATGGTCAACAGCAGGTGGAAGG - Intergenic
1039412094 8:37363457-37363479 TTTCATCACTGGCAGGTGGAAGG - Intergenic
1039744092 8:40408164-40408186 ATTGAGGAATAGCAGGTGGCTGG - Intergenic
1041988795 8:63959482-63959504 TTTGGTCCATAGCAGGTGCGTGG - Intergenic
1044501306 8:92961602-92961624 TATTACCTATAGCAGGTGGAAGG - Intronic
1045206450 8:100046595-100046617 TTGGATCAATCTCAGGTAGAAGG + Intronic
1045424887 8:102055881-102055903 TTTGATCTATAGTAGGAGGCAGG - Intronic
1048188846 8:132269831-132269853 TTTGTTCAAGAGCTGGTAGAGGG + Intronic
1052570805 9:30219924-30219946 TTTAAAAAATAACAGGTGGAAGG + Intergenic
1053636610 9:40012663-40012685 GTAGATCAATATAAGGTGGATGG - Intergenic
1053769382 9:41451953-41451975 GTAGATCAATATAAGGTGGATGG + Intergenic
1054317472 9:63609737-63609759 GTAGATCAATATAAGGTGGATGG - Intergenic
1054548050 9:66363456-66363478 GTAGATCAATATAAGGTGGATGG + Intergenic
1054915366 9:70490677-70490699 TTAGATCAACAGCAGATGGCAGG - Intergenic
1056218686 9:84429914-84429936 TTTAATCAAAAGAATGTGGAAGG - Intergenic
1057757824 9:97852045-97852067 TCTGTTAAATAGCAGCTGGAGGG - Intergenic
1059351671 9:113669800-113669822 TCTGGTCAATAGAATGTGGATGG + Intergenic
1060666362 9:125434336-125434358 GCTGCTCAATAGCAGGTGGGAGG + Intergenic
1062006651 9:134241801-134241823 TTTGGTCACGAGCAGGTGGATGG + Intergenic
1186394803 X:9196845-9196867 TTTAATTAATAGCTGTTGGATGG - Intergenic
1188002214 X:24993731-24993753 TTTAATCAATAACATATGGAAGG - Intronic
1190130985 X:47748849-47748871 TTGGATCAAGAGGTGGTGGATGG - Intergenic
1190993858 X:55585034-55585056 TTCAGTCCATAGCAGGTGGAAGG - Intergenic
1192100201 X:68256153-68256175 TTTGATCAGGAGCAAGGGGAAGG + Intronic
1195994338 X:110716683-110716705 TTTGATAAGTAGTAGTTGGAAGG - Intronic