ID: 1018609396

View in Genome Browser
Species Human (GRCh38)
Location 6:165632826-165632848
Sequence CATTTCCTACTGACATCTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 0, 2: 3, 3: 12, 4: 187}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018609390_1018609396 19 Left 1018609390 6:165632784-165632806 CCTTTGGGCACATGAACTTCTCA 0: 1
1: 0
2: 0
3: 20
4: 162
Right 1018609396 6:165632826-165632848 CATTTCCTACTGACATCTGTGGG 0: 1
1: 0
2: 3
3: 12
4: 187

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018609396 Original CRISPR CATTTCCTACTGACATCTGT GGG Intronic
908688961 1:66755431-66755453 CATTTCCTTTTGACTGCTGTTGG + Intronic
908994737 1:70137590-70137612 CATTTCTTACTGAACTCTGGTGG - Intronic
909187439 1:72506091-72506113 CATTACCAACACACATCTGTTGG - Intergenic
909464890 1:75962131-75962153 CATTTTCTAATGACATCAGCAGG - Intergenic
909946554 1:81670395-81670417 CAGCTCCTACTGCCATCAGTGGG - Intronic
910280574 1:85496222-85496244 CATTTCCTACTGAAAAGTCTTGG + Intronic
910812576 1:91253412-91253434 CATTTCCTAGGGACATGTATAGG - Intergenic
913158101 1:116119980-116120002 CATTTACTGATGACATCAGTGGG + Intronic
913693071 1:121298036-121298058 CATTTTCTTCAGACACCTGTGGG + Intronic
916683474 1:167124654-167124676 AAATTCCTACTAACATCTTTTGG - Intronic
919707553 1:200692423-200692445 CCTTTCTTACTGACTTTTGTTGG + Intergenic
920839232 1:209540000-209540022 CATTTCCTTTTGACCTCAGTAGG + Intergenic
921588444 1:216975912-216975934 CATTTCCTGCTGAGCTTTGTGGG - Intronic
923392033 1:233521702-233521724 CATTTCCTTCTTCCAACTGTTGG + Intergenic
1068317765 10:55369200-55369222 GATTTCCTACTGAGAACTCTAGG - Intronic
1068557516 10:58475774-58475796 CATTTTCTCCTGCCATCTCTCGG + Intergenic
1070822066 10:79363330-79363352 CATTTCAGACTTAAATCTGTGGG - Intergenic
1073032159 10:100535550-100535572 CTTTTCCTTCTGACTTCTTTAGG + Intronic
1074478666 10:113797389-113797411 CATTTCCTAGTGACATCTTTTGG + Intergenic
1078343067 11:10515011-10515033 CATTTGCTCCAGTCATCTGTAGG + Exonic
1078862137 11:15258632-15258654 GAATTCATACTGACATCTGCTGG + Intergenic
1080148821 11:29023855-29023877 AATTTTTTGCTGACATCTGTGGG - Intergenic
1080322195 11:31023345-31023367 CATATCCTACTGTGTTCTGTTGG - Intronic
1087180780 11:95140393-95140415 CATCTCCTAATAACACCTGTCGG + Intergenic
1091995431 12:4989152-4989174 CAGGTGCTACTGGCATCTGTGGG + Intergenic
1094719033 12:33043476-33043498 CACTTCCCACTAACATCTGCAGG - Intergenic
1096841928 12:54385101-54385123 TATTAACTATTGACATCTGTGGG + Intronic
1097429864 12:59491514-59491536 CATTTCTTTCTGAACTCTGTGGG - Intergenic
1097505954 12:60470420-60470442 CATATCCTACTGAAATTCGTTGG - Intergenic
1099045349 12:77710556-77710578 TAATTTCTACTGACATCTTTGGG - Intergenic
1099408700 12:82295826-82295848 CATTTACAATTGATATCTGTAGG + Intronic
1099604265 12:84782302-84782324 GATTTCCTACTGGCATCAGTTGG - Intergenic
1107894837 13:44950980-44951002 CATTTCCTACTGGCATGCTTTGG - Intronic
1109525330 13:63567127-63567149 CATTTCCCAGTGCCATCTGTGGG + Intergenic
1109659801 13:65442304-65442326 CATTTACTAATGTCAACTGTAGG - Intergenic
1110292959 13:73828160-73828182 CATTGCTTTCTGGCATCTGTTGG + Intronic
1111348030 13:86988799-86988821 GATTTCCTATTCACATCTATGGG - Intergenic
1112299476 13:98217104-98217126 CAGTTCCCACTGACATTAGTAGG + Intronic
1112655258 13:101445679-101445701 CATTTCCTACTAAAATCTTGAGG + Intergenic
1114826186 14:26083031-26083053 AATTTCCTAATGACATATGATGG - Intergenic
1116929544 14:50676097-50676119 CCATTCCTACTGAAATCAGTAGG + Intergenic
1117763296 14:59055610-59055632 GAGTTCATACTGACATCTGGAGG + Intergenic
1117810065 14:59536263-59536285 CATCTCCTGCAGACATCTGCAGG + Intronic
1118228316 14:63924118-63924140 CTTTTCCTACTGACTTTTCTTGG + Intronic
1119438865 14:74614802-74614824 CAATTCCTAAAGACATATGTTGG + Intergenic
1120976997 14:90257476-90257498 CATTTCCCTCAGACATCTGCAGG - Intronic
1124261700 15:28198503-28198525 GATTTGTTATTGACATCTGTAGG - Exonic
1126285007 15:47000330-47000352 CATGTCCTACTTACATCTGTTGG - Intergenic
1126318307 15:47394579-47394601 CAGTTCTTGCTGACATCAGTGGG + Intronic
1127862952 15:63009634-63009656 TATTCCCAGCTGACATCTGTAGG + Intergenic
1128377780 15:67089669-67089691 CCTTTCCCAGTGACATCAGTTGG - Intronic
1128957518 15:71964074-71964096 CATATCCTTCTAATATCTGTAGG + Intronic
1129533853 15:76294397-76294419 CAATTCCTGCTAACAACTGTAGG - Intronic
1130819591 15:87480317-87480339 CATTTGCTAACCACATCTGTAGG + Intergenic
1131887439 15:96932446-96932468 CATTACCTACTGGCATCAGCTGG + Intergenic
1132393973 15:101458958-101458980 ATTTTACTACTGACAGCTGTAGG + Intronic
1133556007 16:6907174-6907196 TATGTCCTCCTGGCATCTGTAGG + Intronic
1135105639 16:19646703-19646725 CATATTCTACTGCAATCTGTGGG + Intronic
1137785980 16:51138155-51138177 CATTTCCTACTGATATGTGTTGG - Intronic
1137842119 16:51650351-51650373 CATTTGCTCCTGTCATCTCTGGG + Intergenic
1137962722 16:52899192-52899214 CATCTCATACTGGGATCTGTCGG - Intergenic
1138209367 16:55150392-55150414 CATTTCCCTCTGATACCTGTGGG + Intergenic
1140017936 16:71206137-71206159 CATTTCCACCTGAACTCTGTGGG + Intronic
1140809222 16:78561125-78561147 TGTTTCCTACTGACTTCTGCTGG + Intronic
1145850445 17:28089242-28089264 CTCTTCCCACTGCCATCTGTAGG + Intronic
1152037087 17:77880226-77880248 CATGTCCCTCTGGCATCTGTTGG + Intergenic
1152765493 17:82135570-82135592 CATTTCCAAGTGTCATCTTTGGG - Intronic
1153292337 18:3513832-3513854 TCTTTCCCACTGACCTCTGTGGG + Intronic
1154998907 18:21667596-21667618 TATTCCCTACTGGCATCTTTTGG + Intronic
1155297685 18:24400302-24400324 CAATTCCTACTTATATATGTAGG - Intergenic
1155424394 18:25691099-25691121 CATTTCCAACTGTCATCAGAGGG + Intergenic
1157818907 18:50751208-50751230 CACTCCCCACTGACATGTGTGGG - Intergenic
1159417629 18:68173374-68173396 GATGGCCTACTGGCATCTGTCGG + Intergenic
1164958059 19:32404324-32404346 CCTTTCCTAGTCACCTCTGTTGG - Intergenic
1165057540 19:33187501-33187523 CATTTCCTCCTGAGTTCAGTGGG - Intronic
1168467495 19:56615427-56615449 CATTTGATACTGACACTTGTAGG + Intronic
925389687 2:3486668-3486690 CTCTTCCTCCTGACATGTGTGGG - Intergenic
925802714 2:7617362-7617384 CATTACCTTCTTACATTTGTAGG + Intergenic
926015628 2:9448912-9448934 CTTTTCCTACCCACATCTGAGGG + Intronic
926148760 2:10412844-10412866 CACTTCCCACTGATATGTGTTGG + Intronic
926264190 2:11299452-11299474 AATTTCCTAATGTGATCTGTGGG - Intronic
926893190 2:17656516-17656538 TCTTTCCTACTGACTTATGTTGG - Exonic
929202957 2:39257456-39257478 CATTTCCTCCAGACTCCTGTAGG - Intronic
929801751 2:45110469-45110491 CATAACCTACTGACCTCTGTGGG + Intergenic
935487728 2:103678380-103678402 TATTTCTTACTGACTTCTCTGGG - Intergenic
936481723 2:112890951-112890973 CAATTCCCACTGCCAACTGTCGG - Intergenic
936500928 2:113065724-113065746 CTTTTACTACTGACTTGTGTCGG - Intergenic
937131048 2:119513771-119513793 CATTGCCTACTGTCTTCTCTGGG + Intronic
940665021 2:156598600-156598622 CATTTCCTACAGAGTTCTATGGG + Intronic
940803464 2:158157893-158157915 CAATCCCTACTGGTATCTGTGGG - Intergenic
942469252 2:176242670-176242692 CATTTCCCACAAACATCCGTGGG + Intergenic
944321912 2:198355924-198355946 CATTTCCTACTGAGAATTGATGG + Intronic
944803474 2:203258890-203258912 TATTTCTTACTGACAAATGTTGG - Intronic
944862703 2:203829867-203829889 CATTTTATACTCACATCTGCCGG + Intergenic
945673005 2:212824671-212824693 CATTTCCTCATGAAATCTGATGG + Intergenic
945674785 2:212843053-212843075 TAGTTCCTAATGACATCAGTGGG - Intergenic
1172795922 20:37537518-37537540 CATTTCCTACACACTTTTGTGGG - Intergenic
1173453428 20:43185552-43185574 GATTTACTAGTGTCATCTGTTGG + Intronic
1174709289 20:52687623-52687645 CATTGCCTAATGCCCTCTGTGGG + Intergenic
1175309835 20:58004015-58004037 ATTTTCCTCCTGACATCTCTTGG - Intergenic
1177620549 21:23586106-23586128 GATTTCCTACTGCCATGTGGAGG + Intergenic
1177828925 21:26114896-26114918 CATTTTTTAATGCCATCTGTTGG + Intronic
1181141068 22:20805276-20805298 CATTTGCTACTGGCCACTGTGGG + Intronic
1182456757 22:30456671-30456693 CATTTCCTCCTGAGATTTGGAGG + Intronic
1183091777 22:35527165-35527187 CATTTCCTGGTGCCTTCTGTGGG - Intergenic
1184269368 22:43370080-43370102 CATTTGCAACTGACATCGATAGG + Intergenic
1184660596 22:45963889-45963911 TATTTCCTTCTGGCATCTTTAGG - Intronic
949560794 3:5200344-5200366 CATTTCCTTCAGAAATATGTAGG - Intronic
953002339 3:38947484-38947506 CATTTCCAAATGCCTTCTGTAGG - Intronic
954870238 3:53762209-53762231 GATTTCCTAATGAGAGCTGTAGG + Intronic
954935682 3:54324341-54324363 CATTTACTTCAGACATCTGACGG - Intronic
958645442 3:96865801-96865823 CATGGCCTACTGACATCTGGAGG + Intronic
960263377 3:115593338-115593360 CATCTCCTCTTGACAACTGTGGG - Intergenic
962187435 3:133274645-133274667 CCTTTCCTACTGCCTCCTGTAGG + Intronic
964935284 3:162076892-162076914 CATTCCCTTCTCCCATCTGTTGG + Intergenic
966498999 3:180616071-180616093 AATTTCCTTCTGACTTCTGCTGG - Intronic
967230193 3:187330861-187330883 AACTTCCTTCTAACATCTGTTGG + Intergenic
968789333 4:2648707-2648729 CATTCCCCTCTGCCATCTGTGGG + Intronic
969554516 4:7897132-7897154 CATTTCCAACTGCCTTCTTTGGG + Intronic
970261312 4:14227747-14227769 CATTTTATACTGAGATGTGTTGG - Intergenic
972854546 4:43091014-43091036 CATTTCCTACTAAGTTGTGTGGG + Intergenic
973134476 4:46689390-46689412 GATGGCCTACTGACATCTGCTGG - Intergenic
973152850 4:46909461-46909483 TAATTCCTAGTGACACCTGTTGG + Intergenic
974231994 4:59128100-59128122 CAGTTTCCACTGACATCTCTGGG - Intergenic
978996529 4:115162103-115162125 CTTTTCCCACTGGCATATGTAGG - Intergenic
980514180 4:133832466-133832488 CATTTCCTTCTGATATAAGTAGG + Intergenic
980733851 4:136856472-136856494 CTTTTCTTACTGAAATTTGTAGG + Intergenic
981394856 4:144235100-144235122 CATATCCCACTCATATCTGTAGG - Intergenic
985559710 5:578006-578028 TATTTCCTGTTAACATCTGTAGG - Intergenic
985902629 5:2808550-2808572 ATTTTCCTTCTGACATCTGCTGG - Intergenic
986367869 5:7052703-7052725 CATTGCCTACACACATCTGGAGG - Intergenic
986892195 5:12322116-12322138 CATTTTTTTCTGACATCTGGAGG - Intergenic
989317104 5:40094210-40094232 CAATACCTAATGACATCTTTGGG - Intergenic
993335909 5:86658549-86658571 CATTTCCTTCAGACATTTGGAGG + Intergenic
993491646 5:88558829-88558851 CATTTCCTAATGACATTTTGAGG - Intergenic
995402756 5:111760202-111760224 CGTTTCCTACAGGCATCTGATGG - Intronic
995800120 5:115984877-115984899 CATTTCCTACTGCCATTCTTTGG + Intronic
996577950 5:124997396-124997418 CATTTCCTCCTGAAATTTGCAGG + Intergenic
996923853 5:128800078-128800100 CAGTTCCCACTCCCATCTGTGGG + Intronic
998882921 5:146662336-146662358 TAATTACTACTGCCATCTGTTGG - Intronic
999626366 5:153524845-153524867 TATTTCCTACAGAGACCTGTAGG - Intronic
999966527 5:156816193-156816215 CAGTTGCTACTGCCATCTGCTGG + Intergenic
1000314611 5:160077188-160077210 CAAGTCCTACTGACACCTGTTGG + Intronic
1003030934 6:2600006-2600028 CATTTCCAACTGTCAACTGGTGG - Intergenic
1003747056 6:9014142-9014164 AATTGCCTACAGACTTCTGTGGG + Intergenic
1005130322 6:22499411-22499433 CATTTCCTTCTGTGTTCTGTGGG + Intergenic
1005681562 6:28213879-28213901 AATTACCTACTGCCATCAGTAGG + Intergenic
1006402797 6:33827480-33827502 CACTTCCTACTGCCTTCTATTGG - Intergenic
1006723659 6:36179502-36179524 TATTTTCTACTGTCATCGGTTGG - Intergenic
1007268914 6:40620795-40620817 CATTTCATGTTGACATCTGCCGG - Intergenic
1008407694 6:51136798-51136820 CATTTCCAACTGAGGTATGTGGG - Intergenic
1010152858 6:72756126-72756148 TTTTTCCTACTCACATTTGTAGG + Intronic
1011526336 6:88269378-88269400 CCTTTCCTACTAAAATATGTTGG - Intergenic
1011549031 6:88512210-88512232 CTTTTGCCACTGACATCTCTTGG + Intergenic
1012323732 6:97886719-97886741 CATTTCCAACTTCCTTCTGTGGG + Intergenic
1013059857 6:106622994-106623016 CATTTCATACTTACATTTGGAGG - Intronic
1016407964 6:143750951-143750973 CATTTACTACTGACATCCTCAGG - Intronic
1016566645 6:145462607-145462629 GAATTCCAACTGACATCTGTGGG - Intergenic
1018459309 6:163982402-163982424 CATTTCATTCTCACATCAGTAGG - Intergenic
1018609396 6:165632826-165632848 CATTTCCTACTGACATCTGTGGG + Intronic
1018616209 6:165689421-165689443 CATTTCCTCATGAGATCTGGGGG - Intronic
1019394610 7:810781-810803 CATTTCAACCTGAGATCTGTAGG + Intergenic
1025723924 7:64041149-64041171 CATGTACTACTGATCTCTGTTGG - Intronic
1029689787 7:102173708-102173730 CATTTCCTTCTGAAATGTTTTGG - Intronic
1030503209 7:110386002-110386024 CTTTCCCTTCTGAGATCTGTGGG + Intergenic
1031012474 7:116538135-116538157 CAATTTCTACAGACATTTGTGGG + Intronic
1031340035 7:120588628-120588650 CACCTCCTCCTGACATCTGTGGG + Intronic
1031391241 7:121217502-121217524 CATTTCCTAAAGGCATCTGTTGG + Intronic
1032447600 7:131998085-131998107 TTTTTCCTACTGACATCTGCTGG + Intergenic
1032766709 7:135000959-135000981 TATTTCCAACTAAAATCTGTCGG + Intronic
1033125731 7:138705614-138705636 CATTTACTACTGACAATTATAGG - Intergenic
1033766285 7:144494418-144494440 CAGATCCTACTGGCATCTCTGGG - Intronic
1037695009 8:21215912-21215934 CACTTCCTTCTAAGATCTGTGGG - Intergenic
1040798780 8:51318032-51318054 CATTTGTTACTGTCATCTGCAGG + Intergenic
1041893413 8:62896945-62896967 CATTCATTTCTGACATCTGTGGG + Intronic
1045745887 8:105421515-105421537 CAGTTCCAACTGACTTCAGTGGG - Intronic
1046158076 8:110320137-110320159 CATTACCTACTGACTTTTGTAGG + Intergenic
1050219676 9:3372919-3372941 CATTTTCTACTTAAATCTCTTGG + Intronic
1053527657 9:38846183-38846205 AGTTTCCTACTGACCTTTGTGGG + Intergenic
1054199883 9:62070612-62070634 AGTTTCCTACTGACCTTTGTGGG + Intergenic
1054638473 9:67517745-67517767 AGTTTCCTACTGACCTTTGTGGG - Intergenic
1055635110 9:78269368-78269390 CATTTCCTCCTGAAATCTGCAGG - Intronic
1056871851 9:90289333-90289355 CTGTTCTTACTTACATCTGTGGG - Intergenic
1059831049 9:118096283-118096305 CATTTCCTTTTGTAATCTGTTGG + Intergenic
1059841154 9:118218233-118218255 TGTTGCGTACTGACATCTGTTGG + Intergenic
1060204970 9:121677140-121677162 GATTTCCTGCTGGCCTCTGTAGG + Intronic
1061219915 9:129244325-129244347 CATTTCCTACTGGGATTTGCAGG + Intergenic
1062103287 9:134739298-134739320 GATTTCCTTCTGACACCTGGTGG + Intronic
1185895714 X:3857174-3857196 CATTTCATACTCACTTGTGTAGG + Intergenic
1185900833 X:3895598-3895620 CATTTCATACTCACTTGTGTAGG + Intergenic
1185905948 X:3934037-3934059 CATTTCATACTCACTTGTGTAGG + Intergenic
1186317312 X:8385083-8385105 GAGTTCCCACTGGCATCTGTGGG + Intergenic
1187095595 X:16144472-16144494 CAATTCCTACAGACTTCCGTAGG + Intronic
1188053796 X:25518077-25518099 CAGATCCTACAGAGATCTGTAGG + Intergenic
1188053869 X:25519012-25519034 CATTTATTTCTGACAACTGTGGG - Intergenic
1190970601 X:55343765-55343787 CATTTCCAACTGACATACCTGGG + Intergenic
1193461158 X:81791986-81792008 CATTTCAGACTGCCATATGTTGG + Intergenic
1193804866 X:85983196-85983218 CATATCGTACTTACATCTGATGG + Intronic
1194111793 X:89842720-89842742 CATTCCCTACTGTAATCTCTGGG - Intergenic
1198147791 X:133875200-133875222 CATTTCCAACTGGCATCACTGGG + Intronic
1198809924 X:140524770-140524792 CGTTTCCTGATGACTTCTGTGGG + Intergenic
1200024704 X:153247520-153247542 CATTTTCTACTGACAGCTGGAGG + Intergenic
1200464454 Y:3497510-3497532 CATTCCCTACTGTAATCTCTGGG - Intergenic