ID: 1018610310

View in Genome Browser
Species Human (GRCh38)
Location 6:165641985-165642007
Sequence TTTGACGCCCATTCGGGGCG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 21
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 20}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018610300_1018610310 24 Left 1018610300 6:165641938-165641960 CCACCAGCTGGAGTGGCAGAGGC 0: 1
1: 0
2: 2
3: 42
4: 541
Right 1018610310 6:165641985-165642007 TTTGACGCCCATTCGGGGCGTGG 0: 1
1: 0
2: 0
3: 0
4: 20
1018610301_1018610310 21 Left 1018610301 6:165641941-165641963 CCAGCTGGAGTGGCAGAGGCGTG 0: 1
1: 0
2: 1
3: 34
4: 337
Right 1018610310 6:165641985-165642007 TTTGACGCCCATTCGGGGCGTGG 0: 1
1: 0
2: 0
3: 0
4: 20

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018610310 Original CRISPR TTTGACGCCCATTCGGGGCG TGG Intronic
913449474 1:118983434-118983456 TTAGACGCCCTTTGGGTGCGCGG - Intronic
918047630 1:180951107-180951129 TTTTATGCCCCTTCGGGGTGTGG + Exonic
921714242 1:218401826-218401848 CTTGATGCCCAGTCGGGACGCGG - Intronic
922664394 1:227456243-227456265 TTTGAGGTCCATTAGAGGCGAGG - Intergenic
1069868502 10:71518922-71518944 TTCCATGCCCATTGGGGGCGTGG + Intronic
1097191506 12:57221595-57221617 CTTCAGGCCCATTCGGGGAGCGG - Intronic
1111971376 13:94920385-94920407 TTTGCTGCCAATTGGGGGCGTGG + Intergenic
1121011550 14:90522996-90523018 TGTGGTGCCCATGCGGGGCGTGG - Intergenic
1153553373 18:6285094-6285116 ATTAACGCCCACTCAGGGCGAGG + Intronic
1157553004 18:48594335-48594357 TTCGAGGCCCAGTTGGGGCGGGG - Intronic
1158478993 18:57803788-57803810 TTTGACGCGCATTCGGTGACCGG - Intergenic
1161744593 19:6047989-6048011 TTGGAGGCCCATTCTGGGCACGG + Intronic
1163791859 19:19311435-19311457 TTTGATGCCCAGGCTGGGCGCGG + Intronic
1178981325 21:37267529-37267551 TTTCACGCCCAGAGGGGGCGGGG - Exonic
1183466075 22:37981030-37981052 TTTGATGCCCATCTGGGGAGGGG - Intronic
1001487098 5:172127574-172127596 TTTGAGGCCCACTGGGGGAGGGG - Intronic
1018610310 6:165641985-165642007 TTTGACGCCCATTCGGGGCGTGG + Intronic
1018865879 6:167746709-167746731 TGAGACGCCCGCTCGGGGCGGGG - Intergenic
1022734291 7:33062157-33062179 TTTGACGCGGATCCGGGGGGAGG + Intronic
1022754700 7:33274697-33274719 TTTAAAGGCCATACGGGGCGGGG + Intronic
1029544084 7:101201267-101201289 TTTGACCTCCAGTCGGGGTGGGG + Intergenic