ID: 1018612112

View in Genome Browser
Species Human (GRCh38)
Location 6:165656455-165656477
Sequence GATCTTGGTGGCAGAGTCCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 216
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 193}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018612112_1018612120 24 Left 1018612112 6:165656455-165656477 CCGAGGACTCTGCCACCAAGATC 0: 1
1: 0
2: 2
3: 20
4: 193
Right 1018612120 6:165656502-165656524 AATCCCAGCTCCAGCACAGAGGG 0: 1
1: 0
2: 2
3: 39
4: 325
1018612112_1018612121 25 Left 1018612112 6:165656455-165656477 CCGAGGACTCTGCCACCAAGATC 0: 1
1: 0
2: 2
3: 20
4: 193
Right 1018612121 6:165656503-165656525 ATCCCAGCTCCAGCACAGAGGGG 0: 1
1: 0
2: 8
3: 52
4: 394
1018612112_1018612119 23 Left 1018612112 6:165656455-165656477 CCGAGGACTCTGCCACCAAGATC 0: 1
1: 0
2: 2
3: 20
4: 193
Right 1018612119 6:165656501-165656523 GAATCCCAGCTCCAGCACAGAGG 0: 1
1: 0
2: 3
3: 38
4: 280

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018612112 Original CRISPR GATCTTGGTGGCAGAGTCCT CGG (reversed) Intronic