ID: 1018612112 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 6:165656455-165656477 |
| Sequence | GATCTTGGTGGCAGAGTCCT CGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 216 | |||
| Summary | {0: 1, 1: 0, 2: 2, 3: 20, 4: 193} |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1018612112_1018612120 | 24 | Left | 1018612112 | 6:165656455-165656477 | CCGAGGACTCTGCCACCAAGATC | 0: 1 1: 0 2: 2 3: 20 4: 193 |
||
| Right | 1018612120 | 6:165656502-165656524 | AATCCCAGCTCCAGCACAGAGGG | 0: 1 1: 0 2: 2 3: 39 4: 325 |
||||
| 1018612112_1018612121 | 25 | Left | 1018612112 | 6:165656455-165656477 | CCGAGGACTCTGCCACCAAGATC | 0: 1 1: 0 2: 2 3: 20 4: 193 |
||
| Right | 1018612121 | 6:165656503-165656525 | ATCCCAGCTCCAGCACAGAGGGG | 0: 1 1: 0 2: 8 3: 52 4: 394 |
||||
| 1018612112_1018612119 | 23 | Left | 1018612112 | 6:165656455-165656477 | CCGAGGACTCTGCCACCAAGATC | 0: 1 1: 0 2: 2 3: 20 4: 193 |
||
| Right | 1018612119 | 6:165656501-165656523 | GAATCCCAGCTCCAGCACAGAGG | 0: 1 1: 0 2: 3 3: 38 4: 280 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1018612112 | Original CRISPR | GATCTTGGTGGCAGAGTCCT CGG (reversed) | Intronic | ||