ID: 1018613921

View in Genome Browser
Species Human (GRCh38)
Location 6:165667785-165667807
Sequence TTTTAACACCAGTATCTTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 270
Summary {0: 1, 1: 0, 2: 0, 3: 29, 4: 240}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018613921_1018613922 17 Left 1018613921 6:165667785-165667807 CCATGAAGATACTGGTGTTAAAA 0: 1
1: 0
2: 0
3: 29
4: 240
Right 1018613922 6:165667825-165667847 ATAATCAATACTAAGTTCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018613921 Original CRISPR TTTTAACACCAGTATCTTCA TGG (reversed) Intronic
900303706 1:1991677-1991699 GTGTAACATCAGTATCTTTAAGG + Intronic
901219396 1:7574574-7574596 TTTTAACTCCAGGATCAGCAGGG + Intronic
902956738 1:19930059-19930081 GGTTAACACCAGTTTCTTGATGG + Intergenic
903966530 1:27094080-27094102 TTTTAAGACCAGTGTGTTCTGGG - Intergenic
906944552 1:50284580-50284602 TTTTAACACCAGTGAAGTCAAGG - Intergenic
907062623 1:51446322-51446344 TGTAAAAAACAGTATCTTCAAGG - Intronic
907199634 1:52715408-52715430 TTCTAAAACCAGCAACTTCAGGG + Intergenic
907809365 1:57852873-57852895 TTGTGACAGCAGTATCCTCAGGG + Intronic
908267385 1:62392814-62392836 CTTTAAAAACAGTGTCTTCAGGG + Intergenic
910058021 1:83055095-83055117 TTATAACAACAATTTCTTCAGGG - Intergenic
910518941 1:88095781-88095803 TTAAAACACCAGTACCTTCAGGG + Intergenic
911255297 1:95626185-95626207 TTTTAACACAAGAATATACAAGG - Intergenic
912038505 1:105353542-105353564 TTTACACACCATTATCTGCATGG + Intergenic
912090009 1:106060542-106060564 TCTAAACACCAGTTTCATCATGG - Intergenic
915986688 1:160473099-160473121 TTTTAACACCAGATTGCTCAAGG - Intergenic
916303194 1:163298911-163298933 TTTTATTTCCAGCATCTTCAAGG - Intronic
916717572 1:167458108-167458130 TATTAACACCAGTATTTTGGAGG - Intronic
916980934 1:170136202-170136224 GTTTATCTCCAGGATCTTCAGGG - Intergenic
917333223 1:173903918-173903940 TCTGAACACTATTATCTTCATGG - Exonic
917614230 1:176722168-176722190 TGATAACACCAATATCTTGATGG + Intronic
918388327 1:184033630-184033652 CTTCAACAACAGTATCTTCCAGG + Intronic
918987360 1:191650339-191650361 TTTTATTACCTGTTTCTTCAGGG + Intergenic
1064420769 10:15188848-15188870 TTCCAACACCACCATCTTCATGG - Intergenic
1064676631 10:17766534-17766556 TTCTACCAACAGTCTCTTCAAGG + Intronic
1067920562 10:50452817-50452839 TTTTAACCGTAGCATCTTCAGGG + Intronic
1068135119 10:52945281-52945303 TTTTAAAACCAGCATATTCTAGG - Intergenic
1071330553 10:84554512-84554534 TTTTAAAATGAGTCTCTTCAAGG + Intergenic
1072058274 10:91782639-91782661 TTCTACCAACAGTCTCTTCAAGG + Intergenic
1073522702 10:104149102-104149124 TTTTAATGCCTGTATATTCATGG + Intronic
1074084704 10:110200584-110200606 TTTTAACACCAGTTTAGTCTAGG + Intergenic
1075771710 10:124943938-124943960 AATTAACACCAGTATTTTCAAGG - Intronic
1076711710 10:132339286-132339308 TTTTAAAACCAGTGAGTTCAAGG - Intronic
1078282904 11:9920674-9920696 TTTTAAAACCAGTACTTTGAAGG - Intronic
1080119240 11:28657313-28657335 TTTTCATAACTGTATCTTCAAGG - Intergenic
1080698005 11:34619889-34619911 TTTTAACACAAGTAACTTCTTGG + Intergenic
1081523021 11:43901182-43901204 TATTTTCATCAGTATCTTCAGGG - Intronic
1083314719 11:61807379-61807401 TTTTCACACCAGAATCTCCATGG + Intronic
1087834968 11:102864106-102864128 TGTTATTTCCAGTATCTTCATGG + Intronic
1093123573 12:15301505-15301527 TTCTAACCCCAGTTTCTTGAGGG - Intronic
1093675700 12:21937605-21937627 ATTTCACAGCAGTATTTTCATGG - Intronic
1094143772 12:27207646-27207668 TTTGACCACCACTATCTGCAAGG - Intergenic
1095516502 12:43012116-43012138 TCTTAATACCAGTCTCATCATGG - Intergenic
1095523426 12:43095697-43095719 TTTTAAAATCAGTATCTTGGAGG - Intergenic
1099194236 12:79595901-79595923 CTTTAACAACAGTTTCTTCTTGG - Intronic
1099752495 12:86794552-86794574 TCTTAACAGCAGTATTTTAAGGG - Intronic
1101060479 12:100966030-100966052 TTTTTCCCTCAGTATCTTCAGGG - Intronic
1101908301 12:108844304-108844326 TTTTAAGGCCAGCATGTTCAAGG + Intronic
1102201125 12:111058677-111058699 CTGTAACACCACTATCTGCAAGG - Intronic
1103882763 12:124179084-124179106 TTCTACCAACAGTCTCTTCAAGG - Intronic
1105463659 13:20616866-20616888 TTTTAGCACCATTATCTTATGGG + Intronic
1107089907 13:36467708-36467730 TTTTATAACCAGTTTCTTGATGG + Intergenic
1107842251 13:44470596-44470618 TTCAAACACCAGTATCGTAAAGG - Intronic
1109417517 13:62062451-62062473 TTTTAATACCAGAATTTACAAGG - Intergenic
1110112013 13:71759491-71759513 TTTTAACTCTAATATCTTCATGG + Intronic
1110112113 13:71760800-71760822 TTTTCACCCCAATCTCTTCATGG + Intronic
1111259027 13:85710679-85710701 TTTTAACACCTGAATTTTGAGGG + Intergenic
1112647486 13:101350896-101350918 TGTTAAGACCAAAATCTTCAGGG - Intronic
1113795515 13:113055482-113055504 TTTTATCACCTGGATCTTTAAGG - Intronic
1115184934 14:30676291-30676313 TGTTTACTACAGTATCTTCAGGG - Intronic
1115764823 14:36612971-36612993 TTTTAACAACTCTTTCTTCAAGG + Intergenic
1115884609 14:37957610-37957632 TTTTAAAATCACTATTTTCAGGG - Intronic
1117558494 14:56910965-56910987 TTTAAACACCAGTTTCAACATGG - Intergenic
1120360261 14:83491921-83491943 TTTTAGCATCATTATCTTCAGGG + Intergenic
1120702314 14:87711690-87711712 TATGAACACCAGAATGTTCAAGG + Intergenic
1120807219 14:88765841-88765863 TTTTAAGAACAGTTACTTCATGG + Intronic
1120838191 14:89059885-89059907 TCTTACCAACAGTGTCTTCAAGG + Intergenic
1122472255 14:101977734-101977756 TTTGCACACCAATAGCTTCATGG + Intronic
1124881682 15:33648791-33648813 TTTCAGCACCAGTGTCTTCTGGG + Intronic
1125993982 15:44138474-44138496 TTATAACTCCACTATCTTCAAGG - Intronic
1127849360 15:62899421-62899443 TCTCAACACCAGTATGTCCAAGG + Intergenic
1128874158 15:71188472-71188494 ATTTCACACCAGTATCTCTATGG - Intronic
1128911666 15:71520997-71521019 TTTCAACATCAGTATGGTCACGG - Intronic
1129881342 15:79008361-79008383 TTTGAACTGCAGTATCTTTACGG - Intronic
1130033662 15:80339037-80339059 TTTTCACACTGGTACCTTCAAGG + Intergenic
1130825729 15:87543957-87543979 TTTTAAGATCAGTTTCTTCTGGG - Intergenic
1132129434 15:99261966-99261988 TTTTAACACCATCATCATCTTGG + Intronic
1135015160 16:18919002-18919024 TTGTAAAACCACTGTCTTCAAGG - Intronic
1136243735 16:28960977-28960999 TTCTACCAGCAGTCTCTTCAAGG + Intronic
1136332259 16:29587956-29587978 TTGTAAAACCACTGTCTTCAAGG - Intergenic
1136446954 16:30328025-30328047 TTGTAAAACCACTGTCTTCAAGG - Intergenic
1138840663 16:60500451-60500473 TTTGGAAACCATTATCTTCAAGG + Intergenic
1141542995 16:84741201-84741223 TTTTATCTCCAGTAACATCAGGG + Intronic
1143222076 17:5270933-5270955 TTTTTACAGATGTATCTTCAAGG + Intergenic
1143456765 17:7073008-7073030 TTTTGACACCTGTATCTTGCTGG + Intergenic
1144135455 17:12290811-12290833 TTTTAACACAAGAATTTTGACGG - Intergenic
1145859453 17:28196252-28196274 CTTTCACACCAGTGTCTTCTTGG - Exonic
1148288451 17:46418151-46418173 TTTTAGGACAAGTATCTTCAGGG + Intergenic
1148310619 17:46635736-46635758 TTTTAGGACAAGTATCTTCAGGG + Intronic
1149612911 17:57970705-57970727 TTTTCACTTCAGTATCCTCAAGG - Intergenic
1150473099 17:65454025-65454047 TTTTAACACCAGAATTTTGGAGG - Intergenic
1150750984 17:67862402-67862424 TTCTAACAACAGCATCTTCCAGG + Intronic
1151241203 17:72759509-72759531 TTTTAAAAGCAGTAACATCATGG + Intronic
1152158809 17:78654052-78654074 TTATAAAAGCAGTGTCTTCAGGG - Intergenic
1153761084 18:8333258-8333280 TTTTAACATAAGTAGCCTCAGGG + Intronic
1154339301 18:13489836-13489858 TTTTAACACGAGTGACTTAAAGG + Intronic
1154928987 18:20972876-20972898 TTTTAACTACATTATCTACATGG - Intronic
1154931283 18:20999410-20999432 TTTTGACTCCTGTATCTTCTGGG - Intronic
1155351174 18:24907919-24907941 TTTCAAAACCATTATCTCCAAGG + Intergenic
1157281541 18:46349451-46349473 TTTTAACACCATCATCTTGGGGG + Intronic
1158049738 18:53202336-53202358 TTTGAACACCAGTATAATTAAGG + Intronic
1162463298 19:10826073-10826095 TTTGAACACCAGAATCTGCACGG + Intronic
1168126842 19:54288808-54288830 TTTTCCCACCAGCATCTCCATGG + Intergenic
1168173607 19:54607555-54607577 TTTTCCCACCAGCATCTCCATGG - Intronic
925365740 2:3310738-3310760 ATTTAACGCAAGAATCTTCAGGG + Intronic
928779066 2:34799084-34799106 TATTAACACCAATATCCACATGG + Intergenic
929586447 2:43118193-43118215 TTCTACCAACAGTCTCTTCAAGG + Intergenic
929797658 2:45072467-45072489 TTTTACCACCTGTGTCTTCAGGG - Intergenic
933218144 2:79654116-79654138 TTTTAATAACAGTCTGTTCAAGG + Intronic
934880099 2:97969325-97969347 TTTAATCACCAGTTTCTTCCAGG + Intronic
938030984 2:127992950-127992972 TGTTAACATGAGTATCCTCAGGG + Intronic
938808970 2:134834284-134834306 TTCTACTAACAGTATCTTCAAGG - Intergenic
939067258 2:137498770-137498792 TTGTGACAACATTATCTTCATGG + Intronic
939201336 2:139039202-139039224 TTTAAACACAAATATATTCAAGG + Intergenic
939524522 2:143276101-143276123 TTTTCACACCAGTCTCTTTAAGG - Intronic
939599505 2:144171466-144171488 TTTTGACACCAGTAGGATCAAGG - Intronic
939813913 2:146870679-146870701 TCTTAACACCATTATATTGAGGG + Intergenic
940318960 2:152354242-152354264 CTTCAACAGCAGTTTCTTCAAGG - Intronic
940461971 2:153976339-153976361 CTTAAACTTCAGTATCTTCATGG - Intronic
940788707 2:158009534-158009556 TTTTAAGAACATAATCTTCATGG + Intronic
941797893 2:169621609-169621631 TTTAAACATCAGTAGGTTCAGGG - Intronic
942121125 2:172778545-172778567 TTTTCACACCAGCAACTACAAGG - Intronic
942553230 2:177143518-177143540 ATTTACCACCAGTATCCTCTGGG + Intergenic
942625508 2:177896229-177896251 TAGAAACAGCAGTATCTTCATGG - Intronic
942961074 2:181830232-181830254 TTTTGACAGGAGTTTCTTCATGG - Intergenic
945454057 2:210028490-210028512 ATGTCACACCTGTATCTTCAAGG + Intronic
947691141 2:232137052-232137074 GTTTAACACTAGCATCTGCAAGG - Intronic
948813447 2:240497982-240498004 TTAGAACCCCAGTATCCTCAGGG + Intronic
1169436578 20:5597925-5597947 TTTTAACACCACATACTTCAAGG + Intronic
1169535991 20:6541066-6541088 TTTTGTCACCTGTATCTGCAAGG - Intergenic
1170296048 20:14826915-14826937 TTTTAACACCAGCAGCTTCCAGG - Intronic
1170408085 20:16060529-16060551 TTTTTACACCTATATCTTTAAGG + Intergenic
1170471030 20:16668421-16668443 TATTAACAACAGTATCTTTTGGG + Intergenic
1170901300 20:20465927-20465949 TTGAAACTCCAGTATCTGCAAGG + Intronic
1173425330 20:42937941-42937963 TTTTAACACTAGTTACTTAAAGG - Intronic
1176660274 21:9628209-9628231 TTTGAACACCAGTGCCTTCTAGG + Intergenic
1180856746 22:19051824-19051846 TTTTAACATCAGTAGCCTCAGGG + Intronic
1182873055 22:33665343-33665365 TTTCAACAACAGTATCTCCAGGG + Intronic
1182922282 22:34090971-34090993 TGTTAACAACAGAATCTTCAGGG + Intergenic
1183304718 22:37076450-37076472 TTTGAACAACGGTATCTTCTTGG - Intronic
1183946256 22:41327486-41327508 TGTTAACATCAGGATCTGCATGG - Intronic
951389007 3:22079794-22079816 TTTTAATACCCGTATGTCCAAGG - Intronic
951602461 3:24391473-24391495 TTTTGAAACTAGAATCTTCATGG + Intronic
953769616 3:45770037-45770059 CTTTAACACCACTCTCTTGAGGG - Intronic
954786314 3:53095385-53095407 TTTTAAGTCCAGTATTTTCTTGG - Intronic
955779785 3:62472363-62472385 TTTTAAAAACAGTAGCTCCAAGG + Intronic
956338322 3:68190509-68190531 TTTTAAGACCATTAACCTCAGGG + Intronic
956657918 3:71570043-71570065 TTTCAACCCCATTCTCTTCATGG + Intronic
956669060 3:71669429-71669451 TTTCAAAACCTGTATCGTCATGG + Intergenic
957116956 3:76038580-76038602 TTTTAACACCAGTGTCCCCATGG + Intronic
958172649 3:89957439-89957461 GATTATCACCAGTATCTGCAAGG + Intergenic
960589027 3:119347547-119347569 TTAAAACACCAGTGTCTTCATGG + Intronic
961207477 3:125096595-125096617 TTTTTACATCTGTACCTTCAGGG + Intronic
963107973 3:141662728-141662750 TTTAAAAACCAGTATGTTCTTGG + Intergenic
963275266 3:143323864-143323886 TTTAAATATCAGTATCCTCAGGG - Intronic
965157527 3:165083430-165083452 TTTTTACTCCACTATCTCCAAGG - Intergenic
966745490 3:183271508-183271530 CTCTAACACCAGTAGCTACATGG - Exonic
967571402 3:191032924-191032946 TGTCATCACTAGTATCTTCATGG + Intergenic
967789407 3:193531143-193531165 CTTTTACACCAGTATATGCAAGG - Intronic
970067489 4:12115740-12115762 TTCTAACAACAATATCTTCAGGG + Intergenic
971032885 4:22660101-22660123 TTTTAACACCATTACCTTGGGGG + Intergenic
972978955 4:44672130-44672152 TTTTACCAACAATCTCTTCAAGG - Intronic
973619864 4:52715425-52715447 TTTAAACACAACTATCCTCAGGG - Intergenic
973952715 4:56033795-56033817 TTTTTATATCAGTATCTTCTTGG + Intergenic
974338211 4:60579128-60579150 TTCCAACACAAGTATCTGCAAGG - Intergenic
974938505 4:68436304-68436326 TTTTAACCACAGTATCCCCAGGG - Intergenic
975648269 4:76566823-76566845 TTTTACCACCTGTCTCCTCATGG + Intronic
976940491 4:90696412-90696434 CTTAAACACCTTTATCTTCATGG - Intronic
977770097 4:100847865-100847887 TTTGAACAGGAGTAACTTCAGGG - Intronic
979326842 4:119390144-119390166 TAATAACATCAGTATCTTTAGGG + Intergenic
979369696 4:119869522-119869544 TTTAAACCCCAGTCTCTTTAGGG + Intergenic
982975891 4:162059536-162059558 TAATATCATCAGTATCTTCAAGG + Intronic
983244713 4:165274815-165274837 TAATAACATCAGTATCTTTAGGG + Intronic
984073894 4:175151045-175151067 TTCTAAAATCAGTATCATCAGGG - Intergenic
984403483 4:179296872-179296894 TTTTCAGAACAGTATATTCATGG + Intergenic
985415081 4:189728199-189728221 TTTGAACACCAGTGCCTTCTAGG - Intergenic
986226072 5:5814312-5814334 TTTTTAAACCAGTCTATTCAAGG - Intergenic
986740521 5:10701417-10701439 TTTTAAACCCAGCATCTTTATGG + Intronic
988974310 5:36500019-36500041 ATTTAATACCAGTATGATCATGG - Intergenic
989983879 5:50673373-50673395 TTTAAACTCCATTTTCTTCATGG + Intronic
990167352 5:53009328-53009350 TTTTACCATCAGTCTCCTCAAGG - Intronic
991505799 5:67322803-67322825 TTCAAACACCACTGTCTTCAAGG - Intergenic
991694293 5:69255602-69255624 TTTTACTACCAGTATCTTCTTGG - Intronic
992042557 5:72849097-72849119 TGTTAACACCAGTAACCCCAGGG - Intronic
992707301 5:79409772-79409794 GTTTAACATCATTATCATCAAGG + Intronic
993281673 5:85933234-85933256 TTCTAACATCATCATCTTCAGGG - Intergenic
993707894 5:91192357-91192379 TTTTAACTGCCATATCTTCAAGG - Intergenic
995377756 5:111495489-111495511 TTTTAAAACCATTATCTTAGAGG + Intergenic
995521578 5:113012118-113012140 TTTTAAAAGCCGTATATTCAGGG + Intronic
995616124 5:113966294-113966316 TATTAACACCTGTTACTTCAGGG - Intergenic
997090501 5:130850892-130850914 TTCTAAGGCCAGTATCTTCAGGG - Intergenic
997945326 5:138195237-138195259 TGTTAACACAAGTAACTTAAAGG + Intronic
998351001 5:141501176-141501198 TTTTAACACAATTAAATTCAGGG + Intronic
999920731 5:156317529-156317551 TTTTAACACCATTAACCTGAAGG - Intronic
1001062035 5:168499787-168499809 TGTTAACACCAGTTAATTCAAGG + Intronic
1002667464 5:180835967-180835989 TTATAACACCATTATTTTTACGG + Intergenic
1002823030 6:746409-746431 TTAAAAGACCAGCATCTTCATGG + Intergenic
1003901149 6:10656910-10656932 TTGTAACACCAGACTCTGCAAGG + Intergenic
1004137090 6:12978036-12978058 TTTCAGCTCCCGTATCTTCAAGG + Intronic
1004832495 6:19492223-19492245 TTTTAACACAAATATAATCATGG + Intergenic
1007006532 6:38368825-38368847 TTTTCACACCTCTAACTTCAGGG + Intronic
1008835034 6:55816635-55816657 TTTTAACAGCAGTAATTTGAAGG - Intronic
1009653133 6:66502429-66502451 TTTTTTCACCAGTATTTTCCAGG - Intergenic
1009846183 6:69138089-69138111 TTTTAACAACAGAATGTCCATGG - Intronic
1010090776 6:71978489-71978511 TTTAAAAATCAGTTTCTTCACGG - Intronic
1010595828 6:77763001-77763023 TATAAATGCCAGTATCTTCAAGG - Intronic
1010881459 6:81178698-81178720 TTTTAACCTCAGTCTCTTCATGG - Intergenic
1012430722 6:99161066-99161088 TTTTACCACGAGTATGATCATGG + Intergenic
1014815354 6:125929637-125929659 TTTTCACACGAATATGTTCAAGG - Exonic
1014818218 6:125957560-125957582 ATTTAAAATCAGTATCTTGAAGG - Intronic
1015470962 6:133605850-133605872 TGTTAACAACAGTATTTTCTAGG + Intergenic
1015777590 6:136829995-136830017 TTTTTCCACCAGTATGTTCAGGG + Intronic
1016543962 6:145199512-145199534 TTTTAACACTTGTATTTTTAGGG - Intergenic
1016582032 6:145639027-145639049 TTTTAACATCAGGATTTTTAGGG + Intronic
1017515226 6:155150410-155150432 TTTTAACACCATATTCTTCCAGG - Intronic
1017595571 6:156025358-156025380 TTTTAACACAGGAATTTTCAGGG - Intergenic
1018613921 6:165667785-165667807 TTTTAACACCAGTATCTTCATGG - Intronic
1020788431 7:12595718-12595740 CTTTAAAATCAGAATCTTCAGGG - Intronic
1020830821 7:13092848-13092870 TTTTAACACCATTAGATTGAAGG - Intergenic
1023895381 7:44428682-44428704 TTTTAACATCAGCTTCTTCTTGG - Intronic
1026570876 7:71529279-71529301 TTACAACTCCAATATCTTCAAGG + Intronic
1030027046 7:105334519-105334541 TTTTAATACCAGAAACATCAGGG - Intronic
1030552230 7:110976862-110976884 TTTTAAAATCAGTATTGTCATGG - Intronic
1030992692 7:116319465-116319487 TTTTAACACCTGAATTTTGAAGG - Intronic
1031040723 7:116835899-116835921 TTTTAACACTAGAATTCTCAAGG - Intronic
1031884796 7:127234872-127234894 TTTTAACACAGGTGTCTTCCTGG - Intronic
1033022058 7:137735470-137735492 CTTGTACACCAGTATCTTCAGGG - Intronic
1035571849 8:677618-677640 TTTAAACATCAGTGTGTTCAGGG - Intronic
1036533811 8:9624779-9624801 TTTGAACATCTGCATCTTCAGGG - Intronic
1037467354 8:19173094-19173116 TTTTAACAGAAGTAACTTGATGG - Intergenic
1037524018 8:19707194-19707216 CTTTAGCACCAGTATTTCCATGG - Intronic
1039205341 8:35146843-35146865 TATTAACAGCAGTGTCTTCAGGG - Intergenic
1039234558 8:35487765-35487787 TTCTAGCAACAGTCTCTTCAAGG - Intronic
1039305138 8:36253396-36253418 TGTTAAAAGCAGTATCTTAAAGG - Intergenic
1041410680 8:57550889-57550911 TTTTAACCCCAGGATCCACATGG + Intergenic
1042295590 8:67214070-67214092 TTCTACCAACAGTCTCTTCAGGG - Intronic
1042761324 8:72274570-72274592 TTTCCACACCATTATCTTCTGGG + Intergenic
1043372313 8:79609816-79609838 TATTAAAACCAGTTTCTGCATGG + Intergenic
1044537868 8:93377933-93377955 TTTTAACATAATGATCTTCAGGG - Intergenic
1046402363 8:113720629-113720651 TTTGAACTCTAATATCTTCATGG - Intergenic
1046551302 8:115720613-115720635 TTTAAAAACCAGTTTCATCAGGG - Intronic
1048202860 8:132391239-132391261 TTTTGATACCATCATCTTCATGG - Intronic
1051916470 9:22214550-22214572 TATCAACAGCAGTATGTTCACGG - Intergenic
1052095745 9:24381506-24381528 TTTGCAAACCATTATCTTCAAGG - Intergenic
1052306649 9:27017715-27017737 TTTTAATTCCATTCTCTTCATGG - Intronic
1052489995 9:29154129-29154151 TTTTAAGAGCAGTTTCTTAAAGG - Intergenic
1052707347 9:32009890-32009912 TTTTAGCATCAGTAACTTCAGGG + Intergenic
1054831254 9:69627690-69627712 GTTTAACTCCATTATCCTCAGGG + Intronic
1056028199 9:82523605-82523627 TTTTAACACATGAATCTTCCAGG + Intergenic
1056269183 9:84930073-84930095 TTTGAATATCAGTATCTTGAAGG - Intronic
1056271917 9:84955155-84955177 TTTTAGCACCAGCAGCTACAGGG + Intronic
1056828687 9:89896302-89896324 TTTCAACACGAGAATCATCATGG + Intergenic
1056872178 9:90292152-90292174 TTAAAACACCAGTCTCTTCCAGG - Intergenic
1059511428 9:114851743-114851765 TGTTAACCCCAGTTTATTCAAGG - Intergenic
1061660739 9:132128471-132128493 TTTTAACAGCAGTAATTACATGG + Intergenic
1203637844 Un_KI270750v1:130052-130074 TTTGAACACCAGTGCCTTCTAGG + Intergenic
1186181664 X:6979356-6979378 TTTTTTCACCAGTATGTTCATGG - Intergenic
1189084458 X:38006324-38006346 TTTTTACACCAGTGTTTTAAAGG - Intronic
1189385916 X:40536852-40536874 TTTCAACACCAGAATTTTGAGGG - Intergenic
1192024507 X:67434703-67434725 TTTGAAAACCACTATCTTAAAGG - Intergenic
1193013234 X:76701906-76701928 TTTTATCTCCAGTATTTTGAGGG - Intergenic
1193524624 X:82573710-82573732 ATTTAACACCAGGAACTACAAGG + Intergenic
1193668436 X:84353316-84353338 TTTTAACACTAGTACCTTGGGGG - Intronic
1195870917 X:109484679-109484701 TTACAACACCAGAATGTTCACGG + Intergenic
1196183966 X:112725686-112725708 TTTTAACACCTGAATTTTGAAGG + Intergenic
1196806648 X:119594003-119594025 TTTTATCACCAGTTTCTTTATGG - Intronic
1196861474 X:120032955-120032977 TTCTAACAACAGTCTCTTCAGGG - Intergenic
1201785256 Y:17769769-17769791 TTTTATCACCTGTAGCTTAATGG + Intergenic
1201816297 Y:18136218-18136240 TTTTATCACCTGTAGCTTAATGG - Intergenic
1202345355 Y:23917596-23917618 TTTTATCACCTGTAGCTTAATGG + Intergenic
1202525415 Y:25752493-25752515 TTTTATCACCTGTAGCTTAATGG - Intergenic